Cav3 (NM_007617) Mouse Untagged Clone
CAT#: MC208219
Cav3 (untagged) - Mouse caveolin 3 (Cav3), (10ug)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AI385751; Cav; Cav-3; M-ca; M-cav |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208219 representing NM_007617
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATGACCGAAGAGCACACGGATCTGGAAGCTCGGATCATCAAGGACATTCACTGCAAGGAGATAGACT TGGTGAACCGCGACCCCAAGAACATCAATGAGGACATTGTGAAGGTAGATTTTGAAGACGTGATTGCGGA GCCCGAGGGCACCTACAGCTTCGACGGTGTATGGAAGGTGAGCTTCACCACGTTCACCGTCTCCAAGTAC TGGTGCTACCGCCTGTTGTCTACACTGCTGGGTGTTCCACTGGCCCTGCTCTGGGGATTCCTGTTCGCCT GTATCTCCTTCTGCCACATCTGGGCCGTGGTGCCCTGCATTAAGAGCTACCTGATCGAGATCCAGTGCAT CAGCCACATCTACTCACTGTGTATCCGCACCTTCTGCAACCCGCTCTTCGCTGCGTTGGGCCAGGTCTGC AGCAACATTAAGGTGGTGCTGCGAAGGGAAGGCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_007617 |
Insert Size | 456 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_007617.3, NP_031643.1 |
RefSeq Size | 1172 bp |
RefSeq ORF | 456 bp |
Locus ID | 12391 |
UniProt ID | P51637 |
Gene Summary | This gene belongs to the caveolin family whose members encode the major protein components of caveolae, which are invaginations of plasma membrane. The encoded protein is muscle-specific and forms homooligomers in muscle cells. The protein binds and regulates phosphofructokinase M and neuronal nitric oxide synthase. It also associates with dystrophin in muscle cells. Mutations in this gene are associated with muscular dystrophy. [provided by RefSeq, Apr 2013] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG226246 | Cav3 (tGFP-tagged) - Mouse caveolin 3 (Cav3), (10ug) |
CNY 3,400.00 |
|
MR226246 | Cav3 (Myc-DDK-tagged) - Mouse caveolin 3 (Cav3) |
CNY 1,800.00 |
|
MR226246L3 | Lenti ORF clone of Cav3 (Myc-DDK-tagged) - Mouse caveolin 3 (Cav3) |
CNY 5,890.00 |
|
MR226246L4 | Lenti ORF clone of Cav3 (mGFP-tagged) - Mouse caveolin 3 (Cav3) |
CNY 5,890.00 |