Cd9 (NM_007657) Mouse Untagged Clone
CAT#: MC208269
Cd9 (untagged) - Mouse CD9 antigen (Cd9), (10ug)
CNY 3,840.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Tspan29 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208269 representing NM_007657
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCGGTCAAAGGAGGTAGCAAGTGCATCAAATACCTGCTCTTCGGATTTAACTTCATCTTCTGGCTCG CTGGCATTGCAGTGCTTGCTATTGGACTATGGCTCCGATTCGACTCTCAGACCAAGAGCATCTTCGAGCA AGAGAATAACCATTCCAGTTTCTACACAGGAGTGTACATTCTGATTGGAGCCGGGGCCCTCATGATGCTG GTTGGTTTCCTGGGCTGCTGTGGAGCTGTACAAGAGTCCCAGTGCATGCTGGGATTGTTCTTCGGGTTCC TCTTGGTGATATTCGCCATTGAGATAGCCGCCGCCGTCTGGGGCTATACCCACAAGGATGAGGTGATTAA AGAACTCCAGGAGTTTTACAAGGACACCTACCAAAAGTTACGGAGCAAGGATGAACCCCAGCGGGAAACA CTCAAAGCCATCCATATGGCGTTGGACTGCTGTGGCATAGCTGGTCCTTTGGAGCAGTTTATCTCGGACA CCTGCCCCAAGAAACAGCTTTTGGAAAGTTTCCAGGTTAAGCCCTGCCCTGAAGCCATCAGTGAGGTCTT CAACAACAAGTTCCACATCATTGGAGCAGTGGGTATCGGCATCGCCGTGGTGATGATCTTCGGCATGATC TTCAGCATGATCCTGTGCTGCGCCATCCGCAGGAGCCGAGAAATGGTCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_007657 |
Insert Size | 681 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_007657.3, NP_031683.1 |
RefSeq Size | 1306 bp |
RefSeq ORF | 681 bp |
Locus ID | 12527 |
UniProt ID | P40240 |
Gene Summary | Integral membrane protein associated with integrins, which regulates different processes, such as sperm-egg fusion, platelet activation and aggregation, and cell adhesion (PubMed:10700183, PubMed:10634790, PubMed:10634791, PubMed:14715942). Present at the cell surface of oocytes and plays a key role in sperm-egg fusion, possibly by organizing multiprotein complexes and the morphology of the membrane required for the fusion (PubMed:10700183, PubMed:10634790, PubMed:10634791, PubMed:21690351). In myoblasts, associates with CD81 and PTGFRN and inhibits myotube fusion during muscle regeneration (PubMed:23575678). In macrophages, associates with CD9 and beta-1 and beta-2 integrins, and prevents macrophage fusion into multinucleated giant cells specialized in ingesting complement-opsonized large particles. Also prevents the fusion between mononuclear cell progenitors into osteoclasts in charge of bone resorption (PubMed:12796480). Acts as a receptor for PSG17 (PubMed:11805154). Involved in platelet activation and aggregation (PubMed:14715942). Regulates paranodal junction formation (PubMed:14715942). Involved in cell adhesion, cell motility and tumor metastasis (By similarity). Also regulates integrin-dependent migration of macrophages, particularly relevant for inflammatory response in the lung (PubMed:18662991).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG226288 | Cd9 (tGFP-tagged) - Mouse CD9 antigen (Cd9), (10ug) |
CNY 5,200.00 |
|
MR226288 | Cd9 (Myc-DDK-tagged) - Mouse CD9 antigen (Cd9) |
CNY 3,600.00 |
|
MR226288L3 | Lenti ORF clone of Cd9 (Myc-DDK-tagged) - Mouse CD9 antigen (Cd9) |
CNY 5,890.00 |
|
MR226288L4 | Lenti ORF clone of Cd9 (mGFP-tagged) - Mouse CD9 antigen (Cd9) |
CNY 6,000.00 |