United States
Germany
Japan
United Kingdom
China
Cdx2 (NM_007673) Mouse Untagged Clone
CAT＃: MC208274
Cdx2 (untagged) - Mouse caudal type homeobox 2 (Cdx2), (10ug)
CNY 3,600.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Cdx-2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_007673, the custom clone sequence may differ by one or more nucleotides
ATGTACGTGAGCTACCTTCTGGACAAGGACGTGAGCATGTATCCTAGCTCCGTGCGCCACTCCGGCGGCC TGAACCTGGCTCCGCAGAACTTTGTCAGTCCTCCGCAGTACCCGGACTACGGTGGTTACCACGTGGCGGC CGCGGCGGCTGCTACGGCGAACTTGGACAGCGCTCAGTCCCCAGGGCCATCCTGGCCCACCGCGTACGGC GCCCCTCTCCGCGAGGACTGGAATGGCTACGCACCCGGGGGCGCTGCGGCAGCCAACGCGGTAGCCCACG GTCTCAATGGTGGCTCCCCGGCCGCCGCTATGGGCTACAGCAGCCCCGCCGAATACCACGCGCACCATCA CCCGCATCATCACCCGCACCATCCGGCCGCCTCGCCGTCCTGCGCCTCCGGCTTGCTGCAGACGCTCAAC CTCGGCCCCCCGGGGCCCGCAGCCACCGCCGCCGCCGAACAGCTGTCCCCCAGCGGCCAGCGGCGAAACC TGTGCGAGTGGATGCGGAAGCCCGCGCAGCAGTCCCTAGGAAGCCAAGTGAAAACCAGGACAAAAGACAA ATACCGGGTGGTGTACACAGACCATCAGCGGCTGGAGCTGGAGAAGGAGTTTCACTTTAGTCGATACATC ACCATCAGGAGGAAAAGTGAGCTGGCTGCCACACTTGGGCTCTCCGAGAGGCAGGTTAAAATTTGGTTTC AGAACCGCAGAGCCAAGGAGAGGAAAATCAAGAAGAAGCAGCAGCAGCAACAGCAGCAGCAGCAACAACA GCCTCCACAGCCGCCGCCACAACCTTCCCAGCCTCAGCCGGGTGCCCTGCGGAGCGTGCCGGAGCCCTTG AGTCCTGTGACCTCCTTGCAAGGCTCAGTGCCTGGTTCTGTCCCTGGGGTTCTGGGGCCAGCTGGAGGGG TTTTAAACTCCACTGTCACCCAGTGA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_007673 |
| Insert Size | 936 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC103517, AAI03518 |
| RefSeq Size | 1834 bp |
| RefSeq ORF | 936 bp |
| Locus ID | 12591 |
| UniProt ID | P43241 |
| Gene Summary | Involved in the transcriptional regulation of multiple genes expressed in the intestinal epithelium. Important in broad range of functions from early differentiation to maintenance of the intestinal epithelial lining of both the small and large intestine. Binds preferentially to methylated DNA.[UniProtKB/Swiss-Prot Function] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Tumor-stroma ratio as a new prognosticator for pseudomyxoma peritonei: a comprehensive clinicopathological and immunohistochemical study
,null,
Diagnostic Pathology
,PubMed ID 34895284
[Cdx2]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG226646 | Cdx2 (tGFP-tagged) - Mouse caudal type homeobox 2 (Cdx2), (10ug) |
CNY 4,370.00 |
|
| MR226646 | Cdx2 (Myc-DDK-tagged) - Mouse caudal type homeobox 2 (Cdx2) |
CNY 3,600.00 |
|
| MR226646L1 | Lenti ORF clone of Cdx2 (Myc-DDK-tagged) - Mouse caudal type homeobox 2 (Cdx2) |
CNY 6,000.00 |
|
| MR226646L2 | Lenti ORF clone of Cdx2 (mGFP-tagged) - Mouse caudal type homeobox 2 (Cdx2) |
CNY 5,890.00 |
|
| MR226646L3 | Lenti ORF clone of Cdx2 (Myc-DDK-tagged) - Mouse caudal type homeobox 2 (Cdx2) |
CNY 5,890.00 |
|
| MR226646L4 | Lenti ORF clone of Cdx2 (mGFP-tagged) - Mouse caudal type homeobox 2 (Cdx2) |
CNY 6,000.00 |
