Epo (NM_007942) Mouse Untagged Clone
CAT#: MC208445
Epo (untagged) - Mouse erythropoietin (Epo), (10ug)
CNY 3,600.00
Cited in 2 publications. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208445 representing NM_007942
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGGGTGCCCGAACGTCCCACCCTGCTGCTTTTACTCTCCTTGCTACTGATTCCTCTGGGCCTCCCAG TCCTCTGTGCTCCCCCACGCCTCATCTGCGACAGTCGAGTTCTGGAGAGGTACATCTTAGAGGCCAAGGA GGCAGAAAATGTCACGATGGGTTGTGCAGAAGGTCCCAGACTGAGTGAAAATATTACAGTCCCAGATACC AAAGTCAACTTCTATGCTTGGAAAAGAATGGAGGTGGAAGAACAGGCCATAGAAGTTTGGCAAGGCCTGT CCCTGCTCTCAGAAGCCATCCTGCAGGCCCAGGCCCTGCTAGCCAATTCCTCCCAGCCACCAGAGACCCT TCAGCTTCATATAGACAAAGCCATCAGTGGTCTACGTAGCCTCACTTCACTGCTTCGGGTACTGGGAGCT CAGAAGGAATTGATGTCGCCTCCAGATACCACCCCACCTGCTCCACTCCGAACACTCACAGTGGATACTT TCTGCAAGCTCTTCCGGGTCTACGCCAACTTCCTCCGGGGGAAACTGAAGCTGTACACGGGAGAGGTCTG CAGGAGAGGGGACAGGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_007942 |
Insert Size | 579 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC119265, AAI19266 |
RefSeq Size | 715 bp |
RefSeq ORF | 579 bp |
Locus ID | 13856 |
UniProt ID | P07321 |
Gene Summary | This gene encodes the glycoprotein hormone erythropoietin that regulates the production of red blood cells and biosynthesis of hemoglobin. The predominant expression of this gene shifts from the liver during fetal development to kidney in adults. A complete lack of the encoded protein causes embryonic lethal anemia in mice. The conditional inactivation of this gene in adult mice results in a chronic, normocytic and normochromic anemia. Transgenic mice expressing the human ortholog of this gene exhibit polycythemia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer protein (isoform 1). |
Citations (2)
The use of this cDNA Clones has been cited in the following citations: |
---|
Gene Transfection toward Spheroid Cells on Micropatterned Culture Plates for Genetically-modified Cell Transplantation
,Itaka, K;Uchida, S;Matsui, A;Yanagihara, K;Ikegami, M;Endo, T;Ishii, T;Kataoka, K;,
J Vis Exp
,PubMed ID 26274378
[EPO]
|
An injectable spheroid system with genetic modification for cell transplantation therapy
,Uchida, S;Itaka, K;Nomoto, T;Endo, T;Matsumoto, Y;Ishii, T;Kataoka, K;,
Biomaterials, Jan 2014.
,PubMed ID 24388386
[EPO]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG226885 | Epo (tGFP-tagged) - Mouse erythropoietin (Epo), (10ug) |
CNY 5,200.00 |
|
MR226885 | Epo (Myc-DDK-tagged) - Mouse erythropoietin (Epo) |
CNY 3,600.00 |
|
MR226885L1 | Lenti ORF clone of Epo (Myc-DDK-tagged) - Mouse erythropoietin (Epo) |
CNY 5,890.00 |
|
MR226885L2 | Lenti ORF clone of Epo (mGFP-tagged) - Mouse erythropoietin (Epo) |
CNY 6,000.00 |
|
MR226885L3 | Lenti ORF clone of Epo (Myc-DDK-tagged) - Mouse erythropoietin (Epo) |
CNY 5,890.00 |
|
MR226885L4 | Lenti ORF clone of Epo (mGFP-tagged) - Mouse erythropoietin (Epo) |
CNY 5,890.00 |