Gip (NM_008119) Mouse Untagged Clone
CAT#: MC208552
Gip (untagged) - Mouse gastric inhibitory polypeptide (Gip), (10ug)
CNY 1,800.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208552 representing NM_008119
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGTGGCTTTGAAGACCTGCTCTCTGTTGCTGGTGCTCCTGTTCCTGGCTGTCGGGCTGGGAGAAAAAG AAGAGGTTGAGTTCCGATCCCATGCTAAATTTGCTGGCCCTCGACCTCGAGGTCCAAGGTACGCAGAGGG GACTTTCATCAGTGATTACAGCATCGCCATGGACAAGATCCGACAACAAGACTTCGTGAACTGGCTGCTG GCACAGAGGGGGAAGAAGAGTGACTGGAAACACAACATCACCCAGAGAGAGGCCCGGGCTTTGGTGCTGG CAGGGCAATCTCAGGGAAAGGAGGACAAAGAGGCACAGGGGAGCTCGTTGCCCAAGAGCCTCAGTGATGA TGATGTGCTGAGAGACCTTCTGATTCAAGAGCTACTGGCCTGGATGGTGGACCAAACAGAGCTCTGCCGA CTCAGGTCTCAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_008119 |
Insert Size | 435 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC104314, AAI04315 |
RefSeq Size | 649 bp |
RefSeq ORF | 435 bp |
Locus ID | 14607 |
UniProt ID | P48756 |
Gene Summary | This gene encodes an incretin hormone that belongs to the glucagon superfamily. The encoded preproprotein undergoes proteolytic processing to generate mature peptides that function as potent stimulators of insulin secretion and inhibit gastric acid secretion. Transgenic mice overexpressing the encoded protein exhibit a significant increase in the expression of markers of bone formation, a decrease in the expression of markers of bone resorption and, an increase in the bone mass. [provided by RefSeq, Nov 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG226309 | Gip (tGFP-tagged) - Mouse gastric inhibitory polypeptide (Gip), (10ug) |
CNY 4,370.00 |
|
MR226309 | Gip (Myc-DDK-tagged) - Mouse gastric inhibitory polypeptide (Gip) |
CNY 1,800.00 |
|
MR226309L3 | Lenti ORF clone of Gip (Myc-DDK-tagged) - Mouse gastric inhibitory polypeptide (Gip) |
CNY 5,890.00 |
|
MR226309L4 | Lenti ORF clone of Gip (mGFP-tagged) - Mouse gastric inhibitory polypeptide (Gip) |
CNY 5,890.00 |