Gnas (NM_001077510) Mouse Untagged Clone

CAT#: MC208566

Gnas (untagged) - Mouse GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus (Gnas), transcript variant 8, (10ug)



  "NM_001077510" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
GNAS Antibody - N-terminal region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 5530400H20Rik; A930027G11Rik; C130027O20Rik; G; Ga; Galphas; Gn; Gnas1; Gnasxl; GPSA; Gs-; Gs-alpha; Gsa; GSP; N; Nes; Nesp; Nesp55; Nespl; Oed; Oed-Sml; Oedsml; P; P1; P2; P3; PHP1A; PHP1B; POH; SCG; SCG6; XL
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208566 representing NM_001077510
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGCTGCCTCGGCAACAGTAAGACCGAGGACCAGCGCAACGAGGAGAAGGCGCAGCGCGAGGCCAACA
AAAAGATCGAGAAGCAGCTGCAGAAGGACAAGCAGGTCTACCGGGCCACGCACCGCCTGCTGCTGCTGGG
TGCTGGAGAGTCTGGCAAAAGCACCATTGTGAAGCAGATGAGGATCCTGCATGTTAATGGGTTTAACGGA
GATAGTGAGAAGGCCACTAAAGTGCAGGACATCAAAAACAACCTGAAGGAGGCCATTGAAACCATTGTGG
CCGCCATGAGCAACCTGGTGCCCCCTGTGGAGCTGGCCAACCCTGAGAACCAGTTCAGAGTGGACTACAT
TCTGAGCGTGATGAACGTGCCGAACTTTGACTTCCCACCTGAATTCTATGAGCATGCCAAGGCTCTGTGG
GAGGATGAGGGAGTGCGTGCCTGCTACGAGCGCTCCAATGAGTACCAGCTGATTGACTGTGCCCAGTACT
TCCTGGACAAGATTGATGTGATCAAGCAGGCCGACTACGTGCCAAGTGACCAGGACCTGCTTCGCTGCCG
TGTCCTGACCTCTGGAATCTTTGAGACCAAGTTCCAGGTGGACAAAGTCAACTTCCACATGTTCGATGTG
GGCGGCCAGCGCGATGAGCGCCGCAAGTGGATCCAGTGCTTCAATGATGTGACTGCCATCATCTTCGTGG
TGGCCAGCAGCAGCTACAACATGGTCATTCGGGAGGACAACCAGACTAACCGCCTGCAGGAGGCTCTGAA
CCTCTTCAAGAGCATCTGGAACAACAGATGGCTGCGCACCATCTCTGTGATTCTCTTCCTCAACAAGCAA
GACCTGCTTGCTGAGAAAGTCCTCGCTGGCAAATCGAAGATTGAGGACTACTTTCCAGAGTTCGCTCGCT
ACACCACTCCTGAGGATGCGACTCCCGAGCCGGGAGAGGACCCACGCGTGACCCGGGCCAAGTACTTCAT
TCGGGATGAGTTTCTGAGAATCAGCACTGCTAGTGGAGATGGGCGCCACTACTGCTACCCTCACTTTACC
TGCGCCGTGGACACTGAGAACATCCGCCGTGTCTTCAACGACTGCCGTGACATCATCCAGCGCATGCATC
TCCGCCAATACGAGCTGCTCTAA


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_001077510
Insert Size 1143 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001077510.4, NP_001070978.1
RefSeq Size 1720 bp
RefSeq ORF 1143 bp
Locus ID 14683
UniProt ID P63094
Gene Summary This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, which is commonly found in imprinted genes and correlates with transcript expression. This gene has an antisense transcript. One of the transcripts produced from this locus, and the antisense transcript, are both paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Additional transcript variants have been found for this gene, but the full-length nature and/or biological validity of some variants have not been determined. [provided by RefSeq, Jun 2015]
Transcript Variant: This variant (8) is biallelically expressed. It lacks an internal exon and uses an alternate splice site, compared to variant 7. It encodes the isoform GNASS, also known as alpha-S1, which lacks an internal segment and has two amino acids different, compared to isoform GNASL.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...