Isl1 (NM_021459) Mouse Untagged Clone

CAT#: MC208796

Isl1 (untagged) - Mouse ISL1 transcription factor, LIM/homeodomain (Isl1), (10ug)



  "NM_021459" in other vectors (4)

CNY 3,656.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
ISL1 Antibody - C-terminal region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208796 representing NM_021459
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGAGACATGGGCGATCCACCAAAAAAAAAACGTCTGATTTCCCTGTGTGTTGGTTGCGGCAATCAAA
TTCACGACCAGTATATTCTGAGGGTTTCTCCGGATTTGGAGTGGCATGCAGCATGTTTGAAATGTGCGGA
GTGTAATCAGTATTTGGACGAAAGCTGTACGTGCTTTGTTAGGGATGGGAAAACCTACTGTAAAAGAGAT
TATATCAGGTTGTACGGGATCAAATGCGCCAAGTGCAGCATAGGCTTCAGCAAGAACGACTTCGTGATGC
GCGCCCGCTCTAAGGTGTACCACATCGAGTGTTTCCGCTGTGTAGCCTGCAGCCGACAGCTCATCCCGGG
AGACGAATTCGCCCTGCGGGAGGATGGGCTTTTCTGCCGTGCAGACCACGATGTGGTGGAGAGAGCCAGC
CTGGGAGCTGGAGACCCTCTCAGTCCCTTGCATCCAGCGCGGCCTCTGCAAATGGCAGCCGAACCCATCT
CGGCTAGGCAGCCAGCTCTGCGGCCGCACGTCCACAAGCAGCCGGAGAAGACCACCCGAGTGCGGACTGT
GCTCAACGAGAAGCAGCTGCACACCTTGCGGACCTGCTATGCCGCCAACCCTCGGCCAGATGCGCTCATG
AAGGAGCAACTAGTGGAGATGACGGGCCTCAGTCCCAGAGTCATCCGAGTGTGGTTTCAAAACAAGCGGT
GCAAGGACAAGAAACGCAGCATCATGATGAAGCAGCTCCAGCAGCAGCAACCCAACGACAAAACTAATAT
CCAGGGGATGACAGGAACTCCCATGGTGGCTGCTAGTCCGGAGAGACATGATGGTGGTTTACAGGCTAAC
CCAGTAGAGGTGCAAAGTTACCAGCCGCCCTGGAAAGTACTGAGTGACTTCGCCTTGCAAAGCGACATAG
ATCAGCCTGCTTTTCAGCAACTGGTCAATTTTTCAGAAGGAGGACCAGGCTCTAATTCTACTGGCAGTGA
AGTAGCATCGATGTCCTCGCAGCTCCCAGATACACCCAACAGCATGGTAGCCAGTCCTATTGAGGCATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_021459
Insert Size 1050 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC132609, AAI32610
RefSeq Size 1307 bp
RefSeq ORF 1050 bp
Locus ID 16392
UniProt ID P61372
Gene Summary DNA-binding transcriptional activator (PubMed:14664703, PubMed:24643061, PubMed:25775587, PubMed:22343712). Recognizes and binds to the consensus octamer binding site 5'-ATAATTAA-3' in promoter of target genes (PubMed:24643061, PubMed:25775587). Plays a fundamental role in the gene regulatory network essential for retinal ganglion cell (RGC) differentiation (PubMed:25775587). Cooperates with the transcription factor POU4F2 to achieve maximal levels of expression of RGC target genes and RGC fate specification in the developing retina (PubMed:24643061, PubMed:25775587). Involved in the specification of motor neurons in cooperation with LHX3 and LDB1 (PubMed:18583962). Binds to insulin gene enhancer sequences (By similarity). Essential for heart development. Marker of one progenitor cell population that give rise to the outflow tract, right ventricle, a subset of left ventricular cells, and a large number of atrial cells as well, its function is required for these progenitors to contribute to the heart. Controls the expression of FGF and BMP growth factors in this cell population and is required for proliferation and survival of cells within pharyngeal foregut endoderm and adjacent splanchnic mesoderm as well as for migration of cardiac progenitors into the heart (PubMed:14667410).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...