Itln1 (NM_010584) Mouse Untagged Clone

CAT#: MC208797

Itln1 (untagged) - Mouse intelectin 1 (galactofuranose binding) (Itln1), (10ug)



  "NM_010584" in other vectors (4)

CNY 3,600.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms IntL; Itln; Itln2; Itln3; Itln5; Itlna; Lfr
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208797 representing NM_010584
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACCCAACTGGGATTCCTGCTGTTTATCATGGTTGCTACCAGAGGTTGCAGTGCAGCTGAAGAGAACC
TGGACACCAACAGGTGGGGCAATTCTTTCTTTTCCTCTCTGCCCAGAAGCTGCAAGGAAATCAAGCAGGA
GCACACAAAGGCACAAGATGGTCTCTATTTCCTGCGCACGAAGAATGGTGTCATCTACCAGACCTTCTGT
GACATGACCACTGCAGGTGGTGGCTGGACCCTGGTGGCTAGTGTGCATGAGAACAACATGCGTGGGAAGT
GCACTGTGGGTGATCGCTGGTCCAGTCAGCAAGGCAACAGAGCTGACTACCCAGAGGGGGATGGCAACTG
GGCCAACTACAACACCTTTGGGTCTGCAGAGGCTGCCACAAGTGATGACTACAAGAACCCTGGCTACTTT
GACATCCAGGCTGAGAACCTGGGCATCTGGCACGTGCCCAACAAAAGCCCCCTGCACAACTGGAGGAAGA
GCTCCCTGCTGAGGTACCGCACCTTCACTGGCTTCCTGCAGCACTTGGGACATAATCTGTTTGGCCTCTA
CAAGAAGTACCCAGTGAAATACGGAGAAGGAAAGTGTTGGACTGACAATGGCCCAGCATTACCTGTGGTC
TATGACTTTGGTGATGCTCGGAAGACAGCCTCTTATTACTCCCCCTCTGGCCAGAGGGAATTTACTGCAG
GATATGTTCAGTTCAGAGTGTTTAATAATGAGAGAGCGGCCAGTGCCTTGTGTGCTGGCGTGAGGGTCAC
TGGATGTAATACTGAACATCACTGCATCGGTGGAGGAGGATTCTTCCCAGAAGGTAACCCCGTGCAGTGT
GGAGACTTTGCGTCATTTGATTGGGATGGATATGGAACTCACAATGGGTACAGCAGTAGCCGGAAGATAA
CTGAAGCAGCTGTGCTTCTGTTTTATCGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_010584
Insert Size 942 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_010584.2, NP_034714.1
RefSeq Size 1149 bp
RefSeq ORF 942 bp
Locus ID 16429
UniProt ID O88310
Gene Summary Lectin that specifically recognizes microbial carbohydrate chains in a calcium-dependent manner (PubMed:26148048). Binds to microbial glycans that contain a terminal acyclic 1,2-diol moiety, including beta-linked D-galactofuranose (beta-Galf), D-phosphoglycerol-modified glycans, D-glycero-D-talo-oct-2-ulosonic acid (KO) and 3-deoxy-D-manno-oct-2-ulosonic acid (KDO). Binds to glycans from Gram-positive and Gram-negative bacteria, including K.pneumoniae, S.pneumoniae, Y.pestis, P.mirabilis and P.vulgaris. Does not bind mammalian glycans. Probably plays a role in the defense system against microorganisms. May function as adipokine that has no effect on basal glucose uptake but enhances insulin-stimulated glucose uptake in adipocytes. Increases AKT phosphorylation in the absence and presence of insulin. May interact with lactoferrin/LTF and increase its uptake, and may thereby play a role in iron absorption (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...