Ltc4s (NM_008521) Mouse Untagged Clone
CAT#: MC208907
Ltc4s (untagged) - Mouse leukotriene C4 synthase (Ltc4s), (10ug)
CNY 1,200.00
CNY 3,990.00
Cited in 1 publication. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208907 representing NM_008521
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_008521 |
Insert Size | 453 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_008521.1, NP_032547.1 |
RefSeq Size | 588 bp |
RefSeq ORF | 453 bp |
Locus ID | 17001 |
UniProt ID | Q60860 |
Gene Summary | The protein encoded by this gene is an enzyme that catalyzes the synthesis of leukotriene C4 by combining leukotriene A4 with reduced glutathione. The encoded protein is found in the outer nuclear membrane and in the peripheral endoplasmic reticulum. Leukotrienes have been implicated as mediators of anaphylaxis and inflammatory conditions such as bronchial asthma in humans. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2015] Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Structure and inhibition of mouse leukotriene c4 synthase
,Niegowski, D;Kleinschmidt, T;Ahmad, S;Qureshi, AA;Mårback, M;Rinaldo-Matthis, A;Haeggström, JZ;,
PLoS ONE
,PubMed ID 24810165
[Ltc4s]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG222275 | Ltc4s (tGFP-tagged) - Mouse leukotriene C4 synthase (Ltc4s), (10ug) |
CNY 2,850.00 |
|
MR222275 | Ltc4s (Myc-DDK-tagged) - Mouse leukotriene C4 synthase (Ltc4s) |
CNY 1,200.00 |
|
MR222275L3 | Lenti ORF clone of Ltc4s (Myc-DDK-tagged) - Mouse leukotriene C4 synthase (Ltc4s) |
CNY 4,750.00 |
|
MR222275L4 | Lenti ORF clone of Ltc4s (mGFP-tagged) - Mouse leukotriene C4 synthase (Ltc4s) |
CNY 4,750.00 |