Clec4d (NM_010819) Mouse Untagged Clone

CAT#: MC208972

Clec4d (untagged) - Mouse C-type lectin domain family 4, member d (Clec4d), transcript variant 1, (10ug)



  "NM_010819" in other vectors (5)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Clecsf8; mcl; Mpcl
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208972 representing NM_010819
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTGGCTGGAAGAATCCCAAATGAAATCAAAAGGTACCCGACATCCCCAACTGATCCCTTGCGTCTTCG
CTGTTGTTTCCATCTCGTTCCTTAGTGCTTGCTTTATTTCAACTTGTTTGGTGACTCATCATTACTTTTT
ACGCTGGACGAGAGGAAGTGTGGTGAAACTGTCAGACTACCACACGAGAGTAACGTGCATCCGAGAGGAG
CCACAGCCTGGAGCTACAGGAGGTACTTGGACCTGCTGTCCTGTTAGCTGGAGAGCCTTCCAGTCTAACT
GTTACTTTCCTCTTAATGACAACCAGACCTGGCATGAGAGCGAGAGGAACTGCTCAGGGATGAGCAGTCA
TCTGGTGACCATCAACACCGAAGCAGAACAGAATTTTGTGACCCAGCTTTTGGATAAACGGTTTTCTTAT
TTCCTGGGACTTGCTGATGAGAATGTGGAAGGCCAATGGCAGTGGGTGGACAAGACGCCATTTAACCCAC
ACACGGTATTCTGGGAAAAGGGGGAATCCAATGACTTTATGGAAGAAGACTGTGTTGTCCTTGTTCATGT
CCATGAAAAATGGGTCTGGAATGACTTTCCTTGTCACTTTGAGGTGAGAAGGATTTGTAAATTACCTGGA
ATAACATTCAATTGGAAGCCCTCGAAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_010819
Insert Size 660 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_010819.4, NP_034949.3
RefSeq Size 1336 bp
RefSeq ORF 660 bp
Locus ID 17474
UniProt ID Q9Z2H6
Gene Summary A calcium-dependent lectin involved in innate recognition of pathogen-associated molecular patterns (PAMPs). Interacts with signaling adapter Fc receptor gamma chain/FCER1G, likely via CLEC4E, to form a functional complex in antigen presenting cells. Binding of mycobacterial trehalose 6,6'-dimycolate (TDM) to this receptor complex leads to phosphorylation of the immunoreceptor tyrosine-based activation motif (ITAM) of FCER1G, triggering activation of SYK, CARD9 and NF-kappa-B, consequently driving maturation of antigen-presenting cells and shaping antigen-specific priming of T-cells toward effector T-helper 1 and T-helper 17 cell subtypes (PubMed:23602766). Functions as an endocytic receptor. May be involved in antigen uptake at the site of infection, either for clearance of the antigen, or for processing and further presentation to T-cells (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript from the same strain was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...