Mxi1 (NM_001008543) Mouse Untagged Clone
CAT#: MC208999
Mxi1 (untagged) - Mouse Max interacting protein 1 (Mxi1), transcript variant 3, (10ug)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | bHLHc11; Gm10197; Mad2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208999 representing NM_001008543
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCGAGCCCCCGGCTACAGCACTCGAAGCCCCCACGGAGGTTGAGCCGGGCACAGAAACACAGCAGTG GAAGCAGCAACACCAGCACTGCCAACAGATCTACACACAATGAGTTGGAAAAGAACCGACGAGCTCACCT GCGCCTGTGTTTAGAACGCTTGAAAGTTCTGATCCCGCTGGGCCCAGACTGCACCAGGCACACAACACTC GGTTTGCTCAACAAAGCCAAAGCACACATCAAGAAACTTGAAGAAGCGGAGAGGAAGAGCCAGCACCAGC TAGAGAACTTGGAACGAGAACAGAGGTTTTTAAAGCGGCGACTGGAACAGCTGCAGGGGCCTCAGGAGAT GGAGCGGATACGAATGGACAGCATTGGATCAACCATCTCTTCAGATCGCTCGGATTCAGAGCGAGAGGAG ATTGAAGTGGATGTGGAAAGCACAGAGTTCTCCCATGGAGAAGCAGACAGTGTCAGTACCACCAGCATCA GTGACCTTGACGACCACAGCAGCCTGCAGAGTGTCGGGAGTGACGAGGGTTATTCCAGTGCCAGTGTCAA ACTCTCCTTCGCGTCCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001008543 |
Insert Size | 579 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001008543.2, NP_001008543.1 |
RefSeq Size | 4843 bp |
RefSeq ORF | 579 bp |
Locus ID | 17859 |
UniProt ID | P50540 |
Gene Summary | This gene encodes a protein containing a helix-loop-helix domain characteristic of transcription factors, which allows heterodimerization and sequence-specific DNA binding. The encoded protein is related to a family of Myc/Max/Mad proteins that are involved in the regulation of several cellular processes. The protein encoded by this gene is a transcriptional repressor thought to negatively regulate Myc function. Three alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3), also referred to as WR, differs in the 5' UTR and 5' coding region, compared to variant 1. The resulting isoform (c) is shorter and has a distinct N-terminus, compared to isoform a. This variant is supported by mRNAs and ESTs but the existence of the protein product has not been verified experimentally. Variants 3-6 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR203592 | Mxi1 (Myc-DDK-tagged) - Mouse Max interacting protein 1 (Mxi1), transcript variant 3 |
CNY 2,660.00 |
|
MR203592L3 | Lenti ORF clone of Mxi1 (Myc-DDK-tagged) - Mouse Max interacting protein 1 (Mxi1), transcript variant 3 |
CNY 4,560.00 |
|
MR203592L4 | Lenti ORF clone of Mxi1 (mGFP-tagged) - Mouse Max interacting protein 1 (Mxi1), transcript variant 3 |
CNY 4,560.00 |