Myl1 (NM_001113387) Mouse Untagged Clone
CAT#: MC209005
Myl1 (untagged) - Mouse myosin, light polypeptide 1 (Myl1), transcript variant 3f, (10ug)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AI325107; D12Mgi4; MLC1; MLC1f; MLC3; MLC3f; Myl; Mylf |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209005 representing NM_001113387
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCCTTCAGTGCTGACCAGATTGCCGACTTCAAGGAGGCATTTCTCCTGTTTGACAGAACAGGTGAAT GCAAGATCACCTTAAGTCAGGTGGGAGACGTCCTCCGGGCTCTGGGCACCAATCCCACCAATGCAGAGGT CAAGAAGGTTCTTGGGAACCCCAGCAATGAAGAGATGAATGCTAAGAAAATCGAGTTTGAACAGTTTCTG CCCATGATGCAAGCTATCTCCAACAACAAGGACCAGGGAGGTTATGAAGATTTCGTTGAGGGTCTGCGTG TCTTCGACAAGGAGGGCAATGGCACCGTCATGGGTGCTGAACTCCGCCATGTCCTCGCCACTCTGGGAGA GAAGATGAAGGAGGAAGAGGTAGAAGCGTTGCTGGCAGGCCAGGAGGACTCCAATGGCTGCATCAACTAT GAAGCTTTTGTCAAACACATCATGTCTGTCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001113387 |
Insert Size | 453 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001113387.1, NP_001106858.1 |
RefSeq Size | 826 bp |
RefSeq ORF | 453 bp |
Locus ID | 17901 |
UniProt ID | P05977 |
Gene Summary | Myosin is a hexameric ATPase cellular motor protein. It is composed of two heavy chains, two non-phosphorylatable alkali light chains, and two phosphorylatable regulatory light chains. This gene encodes a myosin alkali light chain expressed in fast skeletal muscle. Multiple transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3f) encodes a protein that is 38 aa shorter than isoform 1f. Transcript variants 3f and 1f differ in their first two exons. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG222142 | Myl1 (tGFP-tagged) - Mouse myosin light polypeptide 1 (Myl1) transcript variant 3f, (10ug) |
CNY 2,090.00 |
|
MR222142 | Myl1 (Myc-DDK-tagged) - Mouse myosin, light polypeptide 1 (Myl1), transcript variant 3f |
CNY 1,900.00 |
|
MR222142L3 | Lenti ORF clone of Myl1 (Myc-DDK-tagged) - Mouse myosin, light polypeptide 1 (Myl1), transcript variant 3f |
CNY 3,800.00 |
|
MR222142L4 | Lenti ORF clone of Myl1 (mGFP-tagged) - Mouse myosin, light polypeptide 1 (Myl1), transcript variant 3f |
CNY 3,800.00 |