United States
Germany
Japan
United Kingdom
China
Pdyn (NM_018863) Mouse Untagged Clone
CAT＃: MC209161
Pdyn (untagged) - Mouse prodynorphin (Pdyn), (10ug)
CNY 3,600.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Dy; Dyn |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC209161 representing NM_018863
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Chromatograms |
CHROMATOGRAMS
 Sequencher program is needed, download here. |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_018863 |
| Insert Size | 747 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_018863.3, NP_061351.2 |
| RefSeq Size | 747 bp |
| RefSeq ORF | 747 bp |
| Locus ID | 18610 |
| Gene Summary | This gene encodes a preproprotein that is proteolytically cleaved to yield a number of active opium-like peptides. These peptides are the endogenous ligands for the Kappa-opioid receptor and similar G-protein-coupled receptors and are thought to function as the body's natural way to control addiction. These peptides have been associated with depression, stress, anxiety, response to pain, and maintenance of homeostasis via circadian rhythms and control of appetite. Mutations in the related human gene have been linked to the neurodegenerative disease spinocerebellar ataxia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013] Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG220994 | Pdyn (tGFP-tagged) - Mouse prodynorphin (Pdyn), (10ug) |
CNY 5,200.00 |
|
| MR220994 | Pdyn (Myc-DDK-tagged) - Mouse prodynorphin (Pdyn) |
CNY 3,600.00 |
|
| MR220994L3 | Lenti ORF clone of Pdyn (Myc-DDK-tagged) - Mouse prodynorphin (Pdyn) |
CNY 4,370.00 |
|
| MR220994L4 | Lenti ORF clone of Pdyn (mGFP-tagged) - Mouse prodynorphin (Pdyn) |
CNY 4,370.00 |
