United States
Germany
Japan
United Kingdom
China
Pln (NM_001141927) Mouse Untagged Clone
CAT＃: MC209191
Pln (untagged) - Mouse phospholamban (Pln), transcript variant 1, (10ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Plb |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC209191 representing NM_001141927
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAAAAAGTGCAATACCTCACTCGCTCGGCTATCAGGAGAGCCTCCACTATTGAAATGCCTCAGCAAG CACGTCAGAATCTCCAGAACCTATTTATCAATTTCTGCCTCATCTTGATATGTCTGCTGCTGATCTGCAT CATTGTGATGCTTCTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001141927 |
| Insert Size | 159 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001141927.1, NP_001135399.1 |
| RefSeq Size | 2480 bp |
| RefSeq ORF | 159 bp |
| Locus ID | 18821 |
| UniProt ID | P61014 |
| Gene Summary | Reversibly inhibits the activity of ATP2A2 in cardiac sarcoplasmic reticulum by decreasing the apparent affinity of the ATPase for Ca(2+). Modulates the contractility of the heart muscle in response to physiological stimuli via its effects on ATP2A2. Modulates calcium re-uptake during muscle relaxation and plays an important role in calcium homeostasis in the heart muscle. The degree of ATP2A2 inhibition depends on the oligomeric state of PLN. ATP2A2 inhibition is alleviated by PLN phosphorylation.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MR200019 | Pln (Myc-DDK-tagged) - Mouse phospholamban (Pln), transcript variant 1 |
CNY 1,800.00 |
|
| MR200019L3 | Lenti ORF clone of Pln (Myc-DDK-tagged) - Mouse phospholamban (Pln), transcript variant 1 |
CNY 3,800.00 |
|
| MR200019L4 | Lenti ORF clone of Pln (mGFP-tagged) - Mouse phospholamban (Pln), transcript variant 1 |
CNY 3,800.00 |
