Ccl5 (NM_013653) Mouse Untagged Clone

CAT#: MC209366

Ccl5 (untagged) - Mouse chemokine (C-C motif) ligand 5 (Ccl5), (10ug)



  "NM_013653" in other vectors (4)

CNY 1,320.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms MuRantes; RANTES; Scya5; SISd; TCP228
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209366 representing NM_013653.
Blue=ORF Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGATCTCTGCAGCTGCCCTCACCATCATCCTCACTGCAGCCGCCCTCTGCACCCCCGCACCTGCC
TCACCATATGGCTCGGACACCACTCCCTGCTGCTTTGCCTACCTCTCCCTCGCGCTGCCTCGTGCCCAC
GTCAAGGAGTATTTCTACACCAGCAGCAAGTGCTCCAATCTTGCAGTCGTGTTTGTCACTCGAAGGAAC
CGCCAAGTGTGTGCCAACCCAGAGAAGAAGTGGGTTCAAGAATACATCAACTATTTGGAGATGAGCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_013653
Insert Size 276 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_013653.3
RefSeq Size 579 bp
RefSeq ORF 276 bp
Locus ID 20304
UniProt ID P30882
MW 10.1 kDa
Gene Summary Chemoattractant for blood monocytes, memory T-helper cells and eosinophils. Causes the release of histamine from basophils and activates eosinophils. May activate several chemokine receptors including CCR1, CCR3, CCR4 and CCR5. May also be an agonist of the G protein-coupled receptor GPR75. Together with GPR75, may play a role in neuron survival through activation of a downstream signaling pathway involving the PI3, Akt and MAP kinases. By activating GPR75 may also play a role in insulin secretion by islet cells.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...