Morf4l1 (NM_024431) Mouse Untagged Clone
CAT#: MC209516
Morf4l1 (untagged) - Mouse mortality factor 4 like 1 (Morf4l1), transcript variant 2, (10ug)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | mKIAA4002; MORFRG15; MRG15; TEG-189; Tex189 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209516 representing NM_024431
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGCCCAAGCAGGACCCTAAGCCGAAATTCCAGGAGGGCGAGCGAGTGCTGTGCTTTCATGGGCCTC TTCTCTATGAAGCAAAGTGTGTAAAGGTTGCCATAAAGGACAAACAAGTGAAATACTTCATCCATTACAG TGGCTGGAATAAAAATTGGGATGAATGGGTGCCAGAAAGCAGAGTACTCAAATACGTGGACACCAATTTG CAGAAACAGCGAGAACTTCAAAAGGCCAATCAGGAACAATATGCAGAGGGCAAGATGAGAGGGGCTGCTC CGGGGAAGAAGACATCCGGCCTGCAACAGAAAAATGTCGAAGTGAAAACAAAAAAGAACAAGCAGAAAAC ACCTGGAAATGGAGATGGTGGCAGTACCAGTGAGACACCTCAGCCTCCTAGGAAGAAGAGAGCCCGGGTA GATCCTACCGTTGAAAATGAAGAAACCTTCATGAACAGAGTTGAAGTTAAAGTGAAGATCCCTGAAGAGC TGAAACCCTGGCTTGTGGATGACTGGGACTTGATCACCAGACAGAAGCAGCTTTTTTATCTTCCTGCCAA GAAGAATGTGGATTCCATTTTGGAGGATTATGCAAATTATAAGAAGTCTCGAGGAAATACAGATAATAAA GAGTATGCTGTTAATGAGGTGGTGGCAGGCATAAAGGAGTACTTCAATGTCATGTTGGGCACTCAGCTCC TCTACAAGTTTGAGAGACCACAGTACGCTGAAATCCTCGCCGACCACCCGGATGCGCCCATGTCCCAGGT GTACGGAGCGCCACATTTGCTGAGATTATTTGTGCGAATTGGAGCGATGTTGGCCTACACGCCTCTAGAT GAGAAAAGCCTTGCTTTATTACTGAACTATCTACATGATTTTCTCAAGTACCTGGCGAAGAATTCTGCAA CCTTGTTCAGTGCCAGTGATTATGAAGTGGCCCCTCCTGAGTACCACCGGAAAGCCGTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_024431 |
Insert Size | 972 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_024431.3, NP_077751.1 |
RefSeq Size | 1896 bp |
RefSeq ORF | 972 bp |
Locus ID | 21761 |
UniProt ID | P60762 |
Gene Summary | Component of the NuA4 histone acetyltransferase complex which is involved in transcriptional activation of select genes principally by acetylation of nucleosomal histones H4 and H2A. This modification may both alter nucleosome - DNA interactions and promote interaction of the modified histones with other proteins which positively regulate transcription. This complex may be required for the activation of transcriptional programs associated with oncogene and proto-oncogene mediated growth induction, tumor suppressor mediated growth arrest and replicative senescence, apoptosis, and DNA repair. The NuA4 complex ATPase and helicase activities seem to be, at least in part, contributed by the association of RUVBL1 and RUVBL2 with EP400. NuA4 may also play a direct role in DNA repair when directly recruited to sites of DNA damage. Also component of the mSin3A complex which acts to repress transcription by deacetylation of nucleosomal histones. Required for homologous recombination repair (HRR) and resistance to mitomycin C (MMC). Involved in the localization of PALB2, BRCA2 and RAD51, but not BRCA1, to DNA-damage foci (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG204686 | Morf4l1 (tGFP-tagged) - Mouse mortality factor 4 like 1 (Morf4l1), transcript variant 2 |
CNY 2,850.00 |
|
MR204686 | Morf4l1 (Myc-DDK-tagged) - Mouse mortality factor 4 like 1 (Morf4l1), transcript variant 2 |
CNY 2,400.00 |
|
MR204686L3 | Lenti ORF clone of Morf4l1 (Myc-DDK-tagged) - Mouse mortality factor 4 like 1 (Morf4l1), transcript variant 2 |
CNY 4,750.00 |
|
MR204686L4 | Lenti ORF clone of Morf4l1 (mGFP-tagged) - Mouse mortality factor 4 like 1 (Morf4l1), transcript variant 2 |
CNY 4,750.00 |
|
MR204698 | Morf4l1 (Myc-DDK-tagged) - Mouse mortality factor 4 like 1 (Morf4l1), transcript variant 2 |
CNY 3,810.00 |
其它Morf4l1产品