Tnfsf11 (NM_011613) Mouse Untagged Clone

CAT#: MC209550

Tnfsf11 (untagged) - Mouse tumor necrosis factor (ligand) superfamily, member 11 (Tnfsf11), (10ug)



  "NM_011613" in other vectors (4)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal anti-RANK-L antibody
    • 100 ug

CNY 8,025.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Ly109l; ODF; OPGL; RANKL; Trance
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209550 representing NM_011613
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCGCCGGGCCAGCCGAGACTACGGCAAGTACCTGCGCAGCTCGGAGGAGATGGGCAGCGGCCCCGGCG
TCCCACACGAGGGTCCGCTGCACCCCGCGCCTTCTGCACCGGCTCCGGCGCCGCCACCCGCCGCCTCCCG
CTCCATGTTCCTGGCCCTCCTGGGGCTGGGACTGGGCCAGGTGGTCTGCAGCATCGCTCTGTTCCTGTAC
TTTCGAGCGCAGATGGATCCTAACAGAATATCAGAAGACAGCACTCACTGCTTTTATAGAATCCTGAGAC
TCCATGAAAACGCAGGTTTGCAGGACTCGACTCTGGAGAGTGAAGACACACTACCTGACTCCTGCAGGAG
GATGAAACAAGCCTTTCAGGGGGCCGTGCAGAAGGAACTGCAACACATTGTGGGGCCACAGCGCTTCTCA
GGAGCTCCAGCTATGATGGAAGGCTCATGGTTGGATGTGGCCCAGCGAGGCAAGCCTGAGGCCCAGCCAT
TTGCACACCTCACCATCAATGCTGCCAGCATCCCATCGGGTTCCCATAAAGTCACTCTGTCCTCTTGGTA
CCACGATCGAGGCTGGGCCAAGATCTCTAACATGACGTTAAGCAACGGAAAACTAAGGGTTAACCAAGAT
GGCTTCTATTACCTGTACGCCAACATTTGCTTTCGGCATCATGAAACATCGGGAAGCGTACCTACAGACT
ATCTTCAGCTGATGGTGTATGTCGTTAAAACCAGCATCAAAATCCCAAGTTCTCATAACCTGATGAAAGG
AGGGAGCACGAAAAACTGGTCGGGCAATTCTGAATTCCACTTTTATTCCATAAATGTTGGGGGATTTTTC
AAGCTCCGAGCTGGTGAAGAAATTAGCATTCAGGTGTCCAACCCTTCCCTGCTGGATCCGGATCAAGATG
CGACGTACTTTGGGGCTTTCAAAGTTCAGGACATAGACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_011613
Insert Size 951 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC131970, AAI31971
RefSeq Size 1320 bp
RefSeq ORF 951 bp
Locus ID 21943
UniProt ID O35235
Gene Summary Cytokine that binds to TNFRSF11B/OPG and to TNFRSF11A/RANK. Osteoclast differentiation and activation factor. Augments the ability of dendritic cells to stimulate naive T-cell proliferation. May be an important regulator of interactions between T-cells and dendritic cells and may play a role in the regulation of the T-cell-dependent immune response. May also play an important role in enhanced bone-resorption in humoral hypercalcemia of malignancy (By similarity). Induces osteoclastogenesis by activating multiple signaling pathways in osteoclast precursor cells, chief among which is induction of long lasting oscillations in the intracellular concentration of Ca (2+) resulting in the activation of NFATC1, which translocates to the nucleus and induces osteoclast-specific gene transcription to allow differentiation of osteoclasts (PubMed:24039232). During osteoclast differentiation, in a TMEM64 and ATP2A2-dependent manner induces activation of CREB1 and mitochondrial ROS generation necessary for proper osteoclast generation (PubMed:23395171, PubMed:26644563).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...