Psma6 (NM_011968) Mouse Untagged Clone

CAT#: MC209731

Psma6 (untagged) - Mouse proteasome (prosome, macropain) subunit, alpha type 6 (Psma6), (10ug)



  "NM_011968" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms IOTA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209731 representing NM_011968
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCCGGGGTTCCAGCGCCGGTTTTGACCGTCACATTACTATCTTCTCTCCCGAGGGCCGACTCTACC
AAGTAGAATATGCTTTTAAGGCTATTAACCAGGGTGGACTTACATCTGTTGCTGTCAGAGGAAAGGACTG
TGCAGTTATTGTCACACAGAAGAAAGTACCCGACAAACTACTGGATTCCAGCACAGTGACTCACTTGTTC
AAGATAACGGAAAGCATTGGCTGTGTGATGACAGGAATGACAGCTGACAGCAGATCCCAGGTACAGAGGG
CACGCTATGAGGCAGCTAATTGGAAATACAAGTATGGCTATGAAATTCCTGTGGACATGCTGTGCAAAAG
AATTGCTGATATTTCTCAAGTCTACACACAGAACGCTGAAATGAGGCCACTCGGTTGTTGTATGATTTTA
ATCGGTATCGATGAAGAGCAAGGCCCTCAAGTGTACAAGTGTGATCCTGCAGGTTACTACTGTGGCTTTA
AAGCCACGGCGGCAGGAGTTAAACAAACAGAGTCAACCAGCTTCCTTGAAAAGAAAGTGAAGAAGAAATT
TGATTGGACATTTGAACAGACAGTGGAAACTGCAATTACATGCCTGTCTACTGTTCTGTCGATTGACTTC
AAACCTTCAGAAATAGAAGTTGGAGTAGTTACAGTTGAAAATCCTAAATTCAGGATTCTTACTGAAGCAG
AGATTGACGCTCACCTTGTTGCTCTAGCAGAGAGAGACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_011968
Insert Size 741 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_011968.3, NP_036098.1
RefSeq Size 997 bp
RefSeq ORF 741 bp
Locus ID 26443
UniProt ID Q9QUM9
Gene Summary Component of the 20S core proteasome complex involved in the proteolytic degradation of most intracellular proteins. This complex plays numerous essential roles within the cell by associating with different regulatory particles. Associated with two 19S regulatory particles, forms the 26S proteasome and thus participates in the ATP-dependent degradation of ubiquitinated proteins. The 26S proteasome plays a key role in the maintenance of protein homeostasis by removing misfolded or damaged proteins that could impair cellular functions, and by removing proteins whose functions are no longer required. Associated with the PA200 or PA28, the 20S proteasome mediates ubiquitin-independent protein degradation. This type of proteolysis is required in several pathways including spermatogenesis (20S-PA200 complex) or generation of a subset of MHC class I-presented antigenic peptides (20S-PA28 complex).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...