Set (NM_023871) Mouse Untagged Clone
CAT#: MC210017
Set (untagged) - Mouse SET nuclear oncogene (Set), transcript variant 1, (10ug)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2610030F17Rik; 5730420M11Rik; AA407739; I-2PP2A; StF-IT-1; TAF-I |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_023871, the custom clone sequence may differ by one or more nucleotides
ATGGCCCCGAAGCGGCAGTCTGCGATCCTGCCTCAGCCCAAGAAACCCAGACCGGCTGCTGCCCCGAAGC TGGAGGACAAGTCGGCCTCTCCCGGCCTGCCGAAGGGAGAAAAAGAACAGCAAGAAGCAATTGAACATAT TGATGAAGTACAAAATGAAATAGACAGACTTAATGAACAAGCCAGTGAGGAAATTTTGAAAGTAGAACAA AAATATAACAAACTCCGCCAACCATTTTTTCAGAAGAGGTCAGAATTGATCGCCAAAATCCCAAATTTTT GGGTAACAACATTTGTCAACCATCCACAAGTGTCTGCACTGCTTGGGGAGGAGGACGAGGAGGCTCTGCA TTATTTGACCAGAGTTGAAGTGACAGAATTTGAAGACATTAAATCAGGTTACAGAATAGATTTTTATTTT GATGAAAATCCTTACTTTGAAAATAAAGTTCTCTCCAAAGAATTTCATCTGAATGAGAGTGGTGACCCGT CTTCAAAGTCCACCGAAATCAAATGGAAATCTGGAAAGGATTTGACAAAACGCTCAAGTCAAACGCAAAA TAAGGCCAGCAGGAAGAGGCAGCACGAAGAGCCAGAGAGCTTCTTTACCTGGTTTACTGACCATTCTGAC GCAGGTGCTGATGAGTTAGGAGAGGTCATCAAAGATGACATCTGGCCAAATCCCTTGCAGTACTACCTGG TTCCCGACATGGATGATGAAGAAGGAGAGGCAGAAGATGATGATGACGACGACGAAGAGGAGGAGGGGCT GGAAGATATTGATGAAGAAGGAGATGAGGATGAAGGTGAAGAAGATGACGATGAGGATGAAGGGGAGGAA GGAGAGGAGGACGAAGGCGAGGATGATTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_023871 |
Insert Size | 870 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC018255, AAH18255 |
RefSeq Size | 1884 bp |
RefSeq ORF | 870 bp |
Locus ID | 56086 |
UniProt ID | Q9EQU5 |
Gene Summary | Multitasking protein, involved in apoptosis, transcription, nucleosome assembly and histone chaperoning. Isoform 2 anti-apoptotic activity is mediated by inhibition of the GZMA-activated DNase, NME1. In the course of cytotoxic T-lymphocyte (CTL)-induced apoptosis, GZMA cleaves SET, disrupting its binding to NME1 and releasing NME1 inhibition. Isoform 1 and isoform 2 are potent inhibitors of protein phosphatase 2A. Isoform 1 and isoform 2 inhibit EP300/CREBBP and PCAF-mediated acetylation of histones (HAT) and nucleosomes, most probably by masking the accessibility of lysines of histones to the acetylases. The predominant target for inhibition is histone H4. HAT inhibition leads to silencing of HAT-dependent transcription and prevents active demethylation of DNA. Both isoforms stimulate DNA replication of the adenovirus genome complexed with viral core proteins; however, isoform 2 specific activity is higher (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longer isoform (1; also known as isoform alpha). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG223300 | Set (tGFP-tagged) - Mouse SET translocation (Set), (10ug) |
CNY 2,850.00 |
|
MR223300 | Set (Myc-DDK-tagged) - Mouse SET nuclear oncogene (Set), transcript variant 1 |
CNY 2,400.00 |
|
MR223300L3 | Lenti ORF clone of Set (Myc-DDK-tagged) - Mouse SET nuclear oncogene (Set), transcript variant 1 |
CNY 4,750.00 |
|
MR223300L4 | Lenti ORF clone of Set (mGFP-tagged) - Mouse SET nuclear oncogene (Set), transcript variant 1 |
CNY 4,750.00 |