Pate4 (NM_020264) Mouse Untagged Clone

CAT#: MC210112

Pate4 (untagged) - Mouse prostate and testis expressed 4 (Pate4), (10ug)



  "NM_020264" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 9530004K16Rik; Pate-B; Svs7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210112 representing NM_020264
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAATTCAGTGACGAAAATCAGCACACTGCTCATCGTGATTTTATCCTTTCTCTGTTTTGTGGAGGGTC
TGATCTGTAATTCATGTGAAAAGTCACGAGATTCAAGATGTACAATGTCACAAAGCAGATGCGTTGCAAA
ACCTGGTGAATCATGCAGTACCGTATCACACTTTGTTGGAACAAAGCATGTGTACTCAAAGCAAATGTGC
TCGCCTCAGTGCAAGGAAAAACAGCTTAACACTGGAAAGAAGTTGATTTACATAATGTGCTGCGAAAAAA
ACTTGTGTAATAGCTTCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_020264
Insert Size 300 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_020264.4, NP_064660.2
RefSeq Size 1016 bp
RefSeq ORF 300 bp
Locus ID 56872
UniProt ID Q09098
Gene Summary Enhances sperm motility. Binds to calmodulin and inhibits calcium transport into spermatozoa. May modulate the function of nicotinic acetylcholine receptors.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...