Xrcc2 (NM_020570) Mouse Untagged Clone

CAT#: MC210148

Xrcc2 (untagged) - Mouse X-ray repair complementing defective repair in Chinese hamster cells 2 (Xrcc2), (10ug)



  "NM_020570" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 4921524O04Rik; 8030409M04Rik; RAD51; RecA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210148 representing NM_020570
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTGTAGCGACTTTCGCAGAGCGGAATCCGGGACAGAGCTCCTTGCCCGACTTGAAGGCAGAAGCTCGT
TGAAAGAACTAGAACCCAACCTGTTTGCTGATGAAGATTCACCAGTGCACGGTGATATTTTTGAATTTCA
TGGTCCAGAAGGAACGGGGAAAACAGAAATGCTTTATCATTTAACAGCCCGATGTATACTTCCAAAATCA
GAGGGTGGACTGCAAATAGAAGTCTTATTTATTGATACAGATTACCACTTTGACATGCTACGGCTCGTGA
CAGTTCTTGAACACAGACTCTCGCAAAGCTCCGAGGAAGCCATGAAGCTGTGCCTAGCCAGGTTGTTCCT
GGCGTACTGCAGCAGCAGCATGCAGTTACTGCTCACGCTGCACTCCCTGGAAGCCCTGCTCTGCAGTCGC
CCCTCTCTCTGCCTTCTCATTGTGGACAGCCTGTCGTCTTTTTACTGGATAGACCGAGTCAGTGGAGGAG
AGAGTGTGGCCCTGCAGGAGTCAACGCTGCAGAAGTGCTCTCAGCTCCTAGAGCGGCTTGTCACTGAGTA
CCGCTTGCTGCTTTTTGCGACAACGCAGAGTCTAATGCAGAAAGGCTCAGACTCTGCAGACGGGCCTTCT
TCCTCCAAGCACCCATGCGATGGAGACATGGGCTACAGAGCCTATCTCTGCAAGGCCTGGCAGAGGGTCG
TGAAGCACAGGGTCATCTTCTCCAGGGACGACGAGGCCAAGAGCAGCCGGTTCTCATTAGTTTCACGTCA
TTTAAAAAGTAACAGTTTAAAAAAACACAGTTTTATGGTCAGAGAAAGTGGGGTGGAGTTTTGTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_020570
Insert Size 837 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_020570.2, NP_065595.2
RefSeq Size 3230 bp
RefSeq ORF 837 bp
Locus ID 57434
UniProt ID Q9CX47
Gene Summary Involved in the homologous recombination repair (HRR) pathway of double-stranded DNA, thought to repair chromosomal fragmentation, translocations and deletions. Part of the Rad21 paralog protein complex BCDX2 which acts in the BRCA1-BRCA2-dependent HR pathway. Upon DNA damage, BCDX2 acts downstream of BRCA2 recruitment and upstream of RAD51 recruitment. BCDX2 binds predominantly to the intersection of the four duplex arms of the Holliday junction and to junction of replication forks. The BCDX2 complex was originally reported to bind single-stranded DNA, single-stranded gaps in duplex DNA and specifically to nicks in duplex DNA (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...