Uqcr11 (NM_025650) Mouse Untagged Clone
CAT#: MC210397
Uqcr11 (untagged) - Mouse ubiquinol-cytochrome c reductase, complex III subunit XI (Uqcr11), nuclear gene encoding mitochondrial protein, (10ug)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 0710008D09Rik; AL022707; Uqcr |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210397 representing NM_025650
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTGAGCAGGTTTCTAGGCCCGCGCTACCGGGAACTGGCCAGAAACTGGATTCCCACAGCCGGCATGT GGGGCACTGTGGGTGCCGTGGGACTGGTGTGGGCCACGGACTGGCGGCTGATCCTGGACTGGGTGCCTTA CATCAACGGCAAGTTTAAGAAGGACGATTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_025650 |
Insert Size | 171 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_025650.2, NP_079926.1 |
RefSeq Size | 436 bp |
RefSeq ORF | 171 bp |
Locus ID | 66594 |
UniProt ID | Q9CPX8 |
Gene Summary | This is a component of the ubiquinol-cytochrome c reductase complex (complex III or cytochrome b-c1 complex), which is part of the mitochondrial respiratory chain.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG217429 | Uqcr11 (tGFP-tagged) - Mouse ubiquinol-cytochrome c reductase complex III subunit XI (Uqcr11) nuclear gene encoding mitochondrial protein, (10ug) |
CNY 2,800.00 |
|
MR217429 | Uqcr11 (Myc-DDK-tagged) - Mouse ubiquinol-cytochrome c reductase, complex III subunit XI (Uqcr11), nuclear gene encoding mitochondrial protein |
CNY 1,200.00 |
|
MR217429L3 | Lenti ORF clone of Uqcr11 (Myc-DDK-tagged) - Mouse ubiquinol-cytochrome c reductase, complex III subunit XI (Uqcr11), nuclear gene encoding mitochondrial protein |
CNY 4,750.00 |
|
MR217429L4 | Lenti ORF clone of Uqcr11 (mGFP-tagged) - Mouse ubiquinol-cytochrome c reductase, complex III subunit XI (Uqcr11), nuclear gene encoding mitochondrial protein |
CNY 4,750.00 |