Eloc (NM_026456) Mouse Untagged Clone

CAT#: MC210654

Tceb1 (untagged) - Mouse transcription elongation factor B (SIII), polypeptide 1 (Tceb1), (10ug)



  "NM_026456" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2610043E24Rik; 2610301I15Rik; AA407206; AI987979; AW049146; Tceb1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210654 representing NM_026456
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATGGAGAGGAGAAGACCTATGGTGGCTGTGAAGGCCCTGATGCTATGTATGTGAAATTAATATCTT
CTGATGGCCATGAATTTATTGTAAAAAGAGAACATGCACTAACATCAGGAACAATAAAGGCTATGTTGAG
TGGTCCAGGTCAGTTTGCTGAGAATGAAACCAACGAGGTCAATTTTAGAGAGATCCCCTCACATGTGCTA
TCAAAAGTGTGCATGTATTTTACCTACAAGGTCCGCTATACTAACAGCTCCACTGAAATTCCTGAATTCC
CAATTGCACCTGAAATTGCACTGGAACTGCTGATGGCTGCAAACTTCCTAGATTGTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_026456
Insert Size 339 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_026456.4, NP_080732.1
RefSeq Size 968 bp
RefSeq ORF 339 bp
Locus ID 67923
UniProt ID P83940
Gene Summary SIII, also known as elongin, is a general transcription elongation factor that increases the RNA polymerase II transcription elongation past template-encoded arresting sites. Subunit A is transcriptionally active and its transcription activity is strongly enhanced by binding to the dimeric complex of the SIII regulatory subunits B and C (elongin BC complex) (By similarity). In embryonic stem cells, the elongin BC complex is recruited by EPOP to Polycomb group (PcG) target genes in order generate genomic region that display both active and repressive chromatin properties, an important feature of pluripotent stem cells (PubMed:27863225, PubMed:27863226).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR and lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...