Selenot (NM_001040396) Mouse Untagged Clone
CAT#: MC210875
Selt (untagged) - Mouse RIKEN cDNA 2810407C02 gene (2810407C02Rik), (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Synonyms | 2810407C02Rik; 5730408P04Rik; Se; Selt |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210875 representing NM_001040396
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGGCTCCTGCTGCTTCTGCTGGTGGCGGCGTCGGCGGTGGTCCGCAGCGAGGCCTCTGCCAACCTGG GCGGCGTGCCCAGCAAGAGATTAAAGATGCAGTACGCCACCGGGCCGCTGCTCAAGTTCCAGATTTGTGT ATCCTGAGGGTACCGGCGGGTGTTTGAGGAGTACATGCGGGTTATCAGCCAGCGGTATCCAGACATCCGC ATTGAAGGCGAGAATTATCTCCCTCAACCAATTTATAGACACATAGCATCTTTCCTGTCAGTCTTCAAAC TAGTATTAATAGGCTTAATAATTGTTGGCAAAGATCCTTTTGCTTTTTTCGGCATGCAAGCTCCTAGCAT CTGGCAGTGGGGCCAAGAAAATAAGGTTTATGCATGTATGATGGTTTTCTTCCTGAGCAACATGATTGAG AACCAGTGTATGTCAACAGGTGCATTTGAGATAACTTTAAATGATGTGCCAGTGTGGTCTAAGCTGGAAT CTGGACATCTTCCATCCATGCAACAACTTGTTCAAATTCTTGACAATGAAATGAAACTCAATGTGCATAT GGATTCAATCCCACATCATCGATCATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001040396 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins. |
OTI Annotation | This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001040396.2, NP_001035486.2 |
RefSeq Size | 3575 bp |
RefSeq ORF | 588 bp |
Locus ID | 69227 |
UniProt ID | P62342 |
Gene Summary | This gene encodes a selenoprotein, containing a selenocysteine (Sec) residue at the active site. Sec is encoded by the UGA codon that normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. This protein is localized in the endoplasmic reticulum. It belongs to the SelWTH family that possesses a thioredoxin-like fold and a conserved CxxU (C is cysteine, U is Sec) motif found in several redox active proteins. Studies in mice indicate a crucial role for this gene in the protection of dopaminergic neurons against oxidative stress in Parkinson's disease, and in the control of glucose homeostasis in pancreatic beta-cells. A pseudogene of this locus has been identified on chromosome 8. [provided by RefSeq, Aug 2017] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201303 | 2810407C02Rik (GFP-tagged) - Mouse RIKEN cDNA 2810407C02 gene (2810407C02Rik), (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) |
CNY 2,850.00 |
|
MR201303 | Sephs2 (Myc-DDK-tagged) - Mouse selenophosphate synthetase 2 (Sephs2), (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) |
CNY 998.00 |
其它Selenot产品