Sirt4 (NM_001167691) Mouse Untagged Clone
CAT#: MC211618
Sirt4 (untagged) - Mouse sirtuin 4 (silent mating type information regulation 2 homolog) 4 (S. cerevisiae) (Sirt4), transcript variant 1, (10ug)
CNY 3,656.00
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 4930596O17Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NM_001167691.1
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGCGGATTGACTTTCAGGCCGACAAAGGGCCGTTGGATCACCCACCTCAGCCGGCCGCGTTCTTGTG GACCCTCGGGGTTATTTGTGCCGCCCAGCCCTCCTTTGGACCCTGAAAAGATCAAAGAGTTACAGCGCTT CATTAGCCTTTCCAAGAAACTCCTCGTGATGACAGGCGCGGGGATCTCCACCGAGTCCGGCATCCCAGAC TACAGGTCAGAAAAGGTGGGACTTTACGCCCGCACTGACCGGAGACCCATCCAGCACATTGATTTCGTCC GCAGTGCTCCGGTCCGCCAGCGGTACTGGGCCCGAAACTTTGTGGGCTGGCCTCAATTCTCCTCTCACCA ACCCAACCCAGCACACTGGGCTCTGAGCAACTGGGAGAGACTGGGGAAGCTGCACTGGTTGGTGACTCAG AACGTGGACGCTTTGCACTCCAAAGCAGGGAGTCAGCGGCTGACGGAGCTCCACGGATGCATGCACAGAG TCCTGTGCCTGAACTGTGGGGAGCAGACTGCCCGCAGGGTGCTGCAGGAACGCTTCCAAGCCCTGAACCC CAGCTGGAGCGCCGAGGCGCAGGGCGTGGCTCCCGACGGCGACGTGTTCCTCACTGAGGAGCAGGTCCGG AGCTTTCAGGTCCCGTGCTGTGATCGATGCGGCGGCCCTCTGAAACCGGACGTCGTTTTCTTTGGGGACA CGGTGAACCCAGACAAGGTTGACTTTGTGCACCGGCGTGTGAAAGAGGCGGACTCCCTACTGGTGGTGGG ATCATCCCTGCAGGTGTACTCTGGTTACAGGTTCATCCTCACCGCCCGCGAGCAAAAGCTCCCAATAGCC ATTCTGAATATCGGCCCCACCCGGTCTGACGATTTGGCTTGCCTGAAGCTGGATTCCCGCTGTGGAGAGT TGCTGCCTTTAATAGACCCGCGGAGACAGCACTCTGATGTCCAAAGGCTGGAAATGAACTTTCCTCTGAG TTCCGCTGCTCAAGATCCCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_001167691 |
Insert Size | 1002 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001167691.1, NP_001161163.1 |
RefSeq Size | 1645 bp |
RefSeq ORF | 1002 bp |
Locus ID | 75387 |
UniProt ID | Q8R216 |
Gene Summary | Acts as NAD-dependent protein lipoamidase, ADP-ribosyl transferase and deacetylase (PubMed:19220062). Catalyzes more efficiently removal of lipoyl- and biotinyl- than acetyl-lysine modifications. Inhibits the pyruvate dehydrogenase complex (PDH) activity via the enzymatic hydrolysis of the lipoamide cofactor from the E2 component, DLAT, in a phosphorylation-independent manner (PubMed:25525879). Catalyzes the transfer of ADP-ribosyl groups onto target proteins, including mitochondrial GLUD1, inhibiting GLUD1 enzyme activity. Acts as a negative regulator of mitochondrial glutamine metabolism by mediating mono ADP-ribosylation of GLUD1: expressed in response to DNA damage and negatively regulates anaplerosis by inhibiting GLUD1, leading to block metabolism of glutamine into tricarboxylic acid cycle and promoting cell cycle arrest (PubMed:16959573). In response to mTORC1 signal, SIRT4 expression is repressed, promoting anaplerosis and cell proliferation (PubMed:23663782). Acts as a tumor suppressor (PubMed:23562301, PubMed:23663782). Also acts as a NAD-dependent protein deacetylase: mediates deacetylation of 'Lys-471' of MLYCD, inhibiting its activity, thereby acting as a regulator of lipid homeostasis (PubMed:23746352). Does not seem to deacetylate PC (PubMed:23438705). Controls fatty acid oxidation by inhibiting PPARA transcriptional activation. Impairs SIRT1:PPARA interaction probably through the regulation of NAD(+) levels (PubMed:24043310, PubMed:20685656). Down-regulates insulin secretion (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG215307 | Sirt4 (tGFP-tagged) - Mouse sirtuin 4 (silent mating type information regulation 2 homolog) 4 (S. cerevisiae) (Sirt4) transcript variant 1, (10ug) |
CNY 2,850.00 |
|
MR215307 | Sirt4 (Myc-DDK-tagged) - Mouse sirtuin 4 (silent mating type information regulation 2 homolog) 4 (S. cerevisiae) (Sirt4), transcript variant 1 |
CNY 2,400.00 |
|
MR215307L3 | Lenti ORF clone of Sirt4 (Myc-DDK-tagged) - Mouse sirtuin 4 (silent mating type information regulation 2 homolog) 4 (S. cerevisiae) (Sirt4), transcript variant 1 |
CNY 4,750.00 |
|
MR215307L4 | Lenti ORF clone of Sirt4 (mGFP-tagged) - Mouse sirtuin 4 (silent mating type information regulation 2 homolog) 4 (S. cerevisiae) (Sirt4), transcript variant 1 |
CNY 4,750.00 |