United States
Germany
Japan
United Kingdom
China
Gper1 (NM_029771) Mouse Untagged Clone
CAT＃: MC211783
Gpr30 (untagged) - Mouse G protein-coupled receptor 30 (Gpr30), (10ug)
CNY 3,656.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 6330420K13Rik; Ceprl; CMKRL2; FEG-1; GPCR-Br; Gper; Gpr30 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_029771, the custom clone sequence may differ by one or more nucleotides
ATGGATGCGACTACTCCAGCCCAAACTGTTGGGGTGGAGATCTACCTAGGTCCCGTGTGGCCAGCCCCTT CCAACAGCACCCCTCTGGCCCTCAACTTGTCCCTGGCACTGCGGGAAGATGCCCCGGGGAACCTCACTGG GGACCTCTCTGAGCATCAGCAGTACGTGATTGCCCTCTTCCTCTCCTGCCTCTACACCATCTTCCTCTTT CCTATTGGCTTTGTGGGCAACATCCTCATCCTGGTGGTGAACATCAGCTTCCGGGAGAAGATGACCATCC CAGACCTGTACTTCATCAACCTGGCGGCGGCCGACCTCATCCTGGTGGCTGACTCCCTGATTGAGGTGTT CAACCTGGACGAGCAGTACTACGACATCGCAGTGCTCTGCACCTTCATGTCCCTCTTCCTGCAGATCAAC ATGTACAGCAGCGTCTTCTTCCTCACCTGGATGAGCTTCGACAGGTACCTAGCGCTGGCCAAGGCCATGC GCTGTGGCCTCTTCCGCACCAAGCACCACGCACGGCTCAGCTGTGGCCTCATCTGGATGGCCTCAGTGTC CGCCACGCTGGTGCCCTTCACAGCGGTGCACCTGCGGCACACGGAGGAGGCCTGCTTCTGCTTTGCTGAT GTCAGGGAGGTGCAGTGGCTGGAGGTCACACTGGGCTTCATCATGCCCTTCGCCATCATTGGCCTCTGCT ACTCCCTCATCGTGCGAGCCCTCATCCGGGCCCACAGGCACCGCGGCCTGCGCCCACGCAGGCAGAAAGC CCTGAGGATGATCTTCGCAGTGGTCCTTGTTTTCTTCATCTGCTGGCTGCCGGAGAACGTCTTCATCAGT GTCCACCTACTGCAGTGGACGCAGCCAGGGGACACTCCCTGCAAGCAGTCTTTCCGTCACGCCTACCCCT TGACAGGCCACATAGTCAACCTTGCAGCCTTCTCCAACAGCTGCCTGAATCCCCTCATCTACAGCTTCCT GGGAGAGACCTTCAGGGACAAGCTCAGGCTCTATGTGGAGCAGAAGACGAGCCTGCCGGCTCTGAACCGC TTCTGCCATGCCACGCTCAAGGCCGTCATTCCAGACAGCACAGAGCAGTCAGAGGTCAGGTTCAGCAGTG CTGTGTGA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_029771 |
| Insert Size | 1128 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC138598, AAI38599 |
| RefSeq Size | 1924 bp |
| RefSeq ORF | 1128 bp |
| Locus ID | 76854 |
| UniProt ID | Q8BMP4 |
| Gene Summary | G-protein coupled estrogen receptor that binds to 17-beta-estradiol (E2) with high affinity, leading to rapid and transient activation of numerous intracellular signaling pathways. Stimulates cAMP production, calcium mobilization and tyrosine kinase Src inducing the release of heparin-bound epidermal growth factor (HB-EGF) and subsequent transactivation of the epidermal growth factor receptor (EGFR), activating downstream signaling pathways such as PI3K/Akt and ERK/MAPK. Mediates pleiotropic functions among others in the cardiovascular, endocrine, reproductive, immune and central nervous systems. Has a role in cardioprotection by reducing cardiac hypertrophy and perivascular fibrosis in a RAMP3-dependent manner. Regulates arterial blood pressure by stimulating vasodilation and reducing vascular smooth muscle and microvascular endothelial cell proliferation. Plays a role in blood glucose homeostasis contributing to the insulin secretion response by pancreatic beta cells. Triggers mitochondrial apoptosis during pachytene spermatocyte differentiation. Stimulates uterine epithelial cell proliferation. Enhances uterine contractility in response to oxytocin. Contributes to thymic atrophy by inducing apoptosis. Attenuates TNF-mediated endothelial expression of leukocyte adhesion molecules. Promotes neuritogenesis in developing hippocampal neurons. Plays a role in acute neuroprotection against NMDA-induced excitotoxic neuronal death. Increases firing activity and intracellular calcium oscillations in luteinizing hormone-releasing hormone (LHRH) neurons. Inhibits early osteoblast proliferation at growth plate during skeletal development. Inhibits mature adipocyte differentiation and lipid accumulation. Involved in the recruitment of beta-arrestin 2 ARRB2 at the plasma membrane in epithelial cells. Functions also as a receptor for aldosterone mediating rapid regulation of vascular contractibility through the PI3K/ERK signaling pathway. Involved in cancer progression regulation. Stimulates cancer-associated fibroblast (CAF) proliferation by a rapid genomic response through the EGFR/ERK transduction pathway. Associated with EGFR, may act as a transcription factor activating growth regulatory genes (c-fos, cyclin D1). Promotes integrin alpha-5/beta-1 and fibronectin (FN) matrix assembly in breast cancer cells.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG227239 | Gpr30 (tGFP-tagged) - Mouse G protein-coupled estrogen receptor 1 (Gper), (10ug) |
CNY 3,710.00 |
|
| MR227239 | Gpr30 (Myc-DDK-tagged) - Mouse G protein-coupled receptor 30 (Gpr30) |
CNY 3,656.00 |
|
| MR227239L3 | Lenti ORF clone of Gpr30 (Myc-DDK-tagged) - Mouse G protein-coupled receptor 30 (Gpr30) |
CNY 5,230.00 |
|
| MR227239L4 | Lenti ORF clone of Gpr30 (mGFP-tagged) - Mouse G protein-coupled receptor 30 (Gpr30) |
CNY 5,230.00 |
