Hamp (NM_032541) Mouse Untagged Clone

CAT#: MC211974

Hamp (untagged) - Mouse hepcidin antimicrobial peptide (Hamp), (10ug)



  "NM_032541" in other vectors (4)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (4)
Rabbit polyclonal anti Hepcidin-25 (ms); purified rabbit IgG
    • 400 ug

CNY 11,419.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Hamp1; Hep; Hepc; Hepc1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_032541, the custom clone sequence may differ by one or more nucleotides


ATGGCACTCAGCACTCGGACCCAGGCTGCCTGTCTCCTGCTTCTCCTCCTTGCCAGCCTGAGCAGCACCA
CCTATCTCCATCAACAGATGAGACAGACTACAGAGCTGCAGCCTTTGCACGGGGAAGAAAGCAGGGCAGA
CATTGCGATACCAATGCAGAAGAGAAGGAAGAGAGACACCAACTTCCCCATCTGCATCTTCTGCTGTAAA
TGCTGTAACAATTCCCAGTGTGGTATCTGTTGCAAAACATAG


Restriction Sites SgfI-MluI     
ACCN NM_032541
Insert Size 252 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC021587, AAH21587
RefSeq Size 393 bp
RefSeq ORF 252 bp
Locus ID 84506
UniProt ID Q9EQ21
Gene Summary This gene encodes hepcidin, an antimicrobial peptide and master hormonal regulator of systemic iron metabolism. The encoded preproprotein is synthesized in the hepatocytes where it undergoes proteolytic processing to generate disulfide-linked mature peptides that are secreted into the bloodstream. Mice lacking the encoded protein develop multivisceral iron overlaod, with sparing of the spleen macrophages. Certain mutations in the human ortholog of this gene cause hemochromatosis type 2B, also known as juvenile hemochromatosis. This gene is located adjacent to a related hepcidin gene on chromosome 7. [provided by RefSeq, Aug 2016]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...