Mapre3 (NM_133350) Mouse Untagged Clone

CAT#: MC212060

Mapre3 (untagged) - Mouse microtubule-associated protein, RP/EB family, member 3 (Mapre3), (10ug)



  "NM_133350" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI790651; EB2; EB3; EBF3; RP3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212060 representing NM_133350
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGTCAATGTGTACTCCACTTCTGTGACCAGTGAGAATCTGAGTCGCCATGATATGCTTGCATGGG
TCAATGACTCTCTGCACCTCAATTATACCAAGATTGAACAGCTCTGTTCAGGGGCAGCCTACTGCCAGTT
CATGGACATGCTCTTCCCTGGCTGTGTTCACTTGAGGAAGGTCAAGTTCCAGGCCAAACTAGAACACGAG
TACATCCACAACTTCAAGGTGCTGCAAGCAGCTTTCAAGAAGATGGGTGTTGACAAAATCATTCCCGTAG
AGAAGTTAGTGAAAGGAAAATTCCAAGATAATTTTGAGTTTATACAGTGGTTTAAGAAATTCTTTGACGC
AAACTATGATGGAAAGGATTACAACCCTCTGCTGGCGCGGCAGGGCCAGGACGTAGCACCACCTCCTAAC
CCAGGTGATCAGATCTTCAACAAATCCAAGAAACTCATTGGCACAGCAGTTCCGCAGAGGACGTCCCCCA
CAGGCCCCAAGAACATGCAGACCTCTGGACGACTCAGCAACGTGGCTCCGCCCTGCATCCTCCGGAAGAA
TCCCCCCTCAGCCCGAAACGGTGGCCATGAGGCTGACGCCCAGATCCTCGAGCTTAACCAGCAGCTGCTG
GACTTGAAGCTGACCGTAGACGGGCTTGAGAAAGAACGAGATTTCTATTTCAGCAAATTGCGAGACATCG
AGCTGATCTGCCAGGAACATGAGAGCGAGAACAGCCCCGTCATCTCGGGCATCATTGGCATTCTCTATGC
CACGGAGGAGGGATTTGCACCCCCTGAGGATGATGAGATTGAAGAACACCAACAGGAAGACCAGGACGAG
TACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_133350
Insert Size 846 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_133350.2, NP_579928.1
RefSeq Size 2021 bp
RefSeq ORF 846 bp
Locus ID 100732
UniProt ID Q6PER3
Gene Summary Plus-end tracking protein (+TIP) that binds to the plus-end of microtubules and regulates the dynamics of the microtubule cytoskeleton. Promotes microtubule growth. May be involved in spindle function by stabilizing microtubules and anchoring them at centrosomes. Also acts as a regulator of minus-end microtubule organization: interacts with the complex formed by AKAP9 and PDE4DIP, leading to recruit CAMSAP2 to the Golgi apparatus, thereby tethering non-centrosomal minus-end microtubules to the Golgi, an important step for polarized cell movement. Promotes elongation of CAMSAP2-decorated microtubule stretches on the minus-end of microtubules (By similarity). May play a role in cell migration (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...