Npy (NM_023456) Mouse Untagged Clone
CAT#: MC212210
Npy (untagged) - Mouse neuropeptide Y (Npy), (10ug)
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 0710005A05Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_023456, the custom clone sequence may differ by one or more nucleotides
ATGCTAGGTAACAAGCGAATGGGGCTGTGTGGACTGACCCTCGCTCTATCTCTGCTCGTGTGTTTGGGCA TTCTGGCTGAGGGGTACCCCTCCAAGCCGGACAATCCGGGCGAGGACGCGCCAGCAGAGGACATGGCCAG ATACTACTCCGCTCTGCGACACTACATCAATCTCATCACCAGACAGAGATATGGCAAGAGATCCAGCCCT GAGACACTGATTTCAGACCTCTTAATGAAGGAAAGCACAGAAAACGCCCCCAGAACAAGGCTTGAAGACC CTTCCATGTGGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_023456 |
Insert Size | 294 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC043012, AAH43012 |
RefSeq Size | 561 bp |
RefSeq ORF | 294 bp |
Locus ID | 109648 |
UniProt ID | P57774 |
Gene Summary | This gene encodes a neuropeptide that plays a pivotal role in many physiological functions such as food intake, energy homeostasis, circadian rhythm, and cognition. The encoded protein precursor undergoes proteolytic processing to generate the biologically active peptide. Mice lacking the encoded protein exhibit mild seizures occasionally and become hyperphagic following food deprivation. A deficiency of the encoded protein partially prevents mice lacking leptin from becoming obese. [provided by RefSeq, Oct 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG226370 | Npy (tGFP-tagged) - Mouse neuropeptide Y (Npy), (10ug) |
CNY 2,800.00 |
|
MR226370 | Npy (Myc-DDK-tagged) - Mouse neuropeptide Y (Npy) |
CNY 1,200.00 |
|
MR226370L3 | Lenti ORF clone of Npy (Myc-DDK-tagged) - Mouse neuropeptide Y (Npy) |
CNY 4,750.00 |
|
MR226370L4 | Lenti ORF clone of Npy (mGFP-tagged) - Mouse neuropeptide Y (Npy) |
CNY 4,750.00 |