Elmo1 (NM_198093) Mouse Untagged Clone

CAT#: MC212310

Elmo1 (untagged) - Mouse engulfment and cell motility 1, ced-12 homolog (C. elegans) (Elmo1), transcript variant 2, (10ug)



CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 6330578D22Rik; C230095H21Rik; CED-12
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212310 representing NM_198093
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAGGTGGTGAAGGAGCAGGTTATGAGAGCGCTTACAACCAAGCCTAGTTCCCTGGACCAGTTCAAAA
GCAAGCTGCAAAACCTGAGCTACACCGAGATCCTGAAAATCCGCCAGTCTGAGAGGATGAACCAGGAAGA
TTTCCAGTCTCGCCCGATTTTGGAACTAAAGGAGAAGATCCAGCCAGAAATCTTAGAGCTGATTAAACAG
CAGCGCCTGAACCGCCTTGTGGAAGGGACCTGCTTTAGGAAACTCAATGCTCGCCGGAGACAAGACAAGT
TTTGGTATTGTCGGCTTTCACCAAATCACAAGGTCTTACATTATGGCGACTTGGAAGAGAGCCCCCAAGG
AGAAGTGCCCCACGATTCCCTGCAGGACAAATTGCCGGTGGCAGATATCAAAGCAGTGGTGACGGGAAAG
GACTGCCCTCATATGAAAGAGAAAGGTGCCCTTAAACAAAACAAGGAGGTGCTTGAACTTGCTTTCTCCA
TCTTATACGACTCAAATTGCCAACTGAACTTCATTGCTCCTGATAAGCATGAGTACTGCATCTGGACAGA
TGGGCTGAATGCACTGCTTGGGAAGGACATGATGAGTGACCTGACACGCAATGACCTGGACACCCTGCTG
AGCATGGAGATCAAGCTTCGCCTGCTGGACCTGGAAAACATCCAGATCCCGGATGCACCTCCGCCTATCC
CCAAGGAACCTAGCAACTATGACTTTGTCTATGACTGTAACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_198093
Insert Size 744 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_198093.3, NP_932761.1
RefSeq Size 4114 bp
RefSeq ORF 744 bp
Locus ID 140580
UniProt ID Q8BPU7
Gene Summary Involved in cytoskeletal rearrangements required for phagocytosis of apoptotic cells and cell motility. Acts in association with DOCK1 and CRK. Was initially proposed to be required in complex with DOCK1 to activate Rac Rho small GTPases. May enhance the guanine nucleotide exchange factor (GEF) activity of DOCK1 (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) represents use of an alternate promoter and differs in the 5' UTR and 5' coding region, compared to variant 3. These differences cause translation initiation at a downstream AUG and result in an isoform (2) with a shorter N-terminus, compared to isoform 3.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...