United States
Germany
Japan
United Kingdom
China
Havcr2 (NM_134250) Mouse Untagged Clone
CAT＃: MC212431
Havcr2 (untagged) - Mouse hepatitis A virus cellular receptor 2 (Havcr2), (10ug)
CNY 3,600.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | TIM-3; Tim3; Timd3 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC212431 representing NM_134250
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTTTTCAGGTCTTACCCTCAACTGTGTCCTGCTGCTGCTGCAACTACTACTTGCAAGGTCATTGGAAA ATGCTTATGTGTTTGAGGTTGGTAAGAATGCCTATCTGCCCTGCAGTTACACTCTATCTACACCTGGGGC ACTTGTGCCTATGTGCTGGGGCAAGGGATTCTGTCCTTGGTCACAGTGTACCAACGAGTTGCTCAGAACT GATGAAAGAAATGTGACATATCAGAAATCCAGCAGATACCAGCTAAAGGGCGATCTCAACAAAGGAGACG TGTCTCTGATCATAAAGAATGTGACTCTGGATGACCATGGGACCTACTGCTGCAGGATACAGTTCCCTGG TCTTATGAATGATAAAAAATTAGAACTGAAATTAGACATCAAAGCAGCCAAGGTCACTCCAGCTCAGACT GCCCATGGGGACTCTACTACAGCTTCTCCAAGAACCCTAACCACGGAGAGAAATGGTTCAGAGACACAGA CACTGGTGACCCTCCATAATAACAATGGAACAAAAATTTCCACATGGGCTGATGAAATTAAGGACTCTGG AGAAACGATCAGAACTGCTATCCACATTGGAGTGGGAGTCTCTGCTGGGTTGACCCTGGCACTTATCATT GGTGTCTTAATCCTTAAATGGTATTCCTGTAAGAAAAAGAAGTTATCGAGTTTGAGCCTTATTACACTGG CCAACTTGCCTCCAGGAGGGTTGGCAAATGCAGGAGCAGTCAGGATTCGCTCTGAGGAAAATATCTACAC CATCGAGGAGAACGTATATGAAGTGGAGAATTCAAATGAGTACTACTGCTACGTCAACAGCCAGCAGCCA TCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Chromatograms |
CHROMATOGRAMS
 Sequencher program is needed, download here. |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_134250 |
| Insert Size | 846 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC106851, AAI06852 |
| RefSeq Size | 2725 bp |
| RefSeq ORF | 846 bp |
| Locus ID | 171285 |
| UniProt ID | Q8VIM0 |
| Gene Summary | Cell surface receptor implicated in modulating innate and adaptive immune responses. Generally accepted to have an inhibiting function. Reports on stimulating functions suggest that the activity may be influenced by the cellular context and/or the respective ligand (PubMed:18006747). Regulates macrophage activation (PubMed:11823861). Inhibits T-helper type 1 lymphocyte (Th1)-mediated auto- and alloimmune responses and promotes immunological tolerance (PubMed:14556006, PubMed:18006747). In CD8+ cells attenuates TCR-induced signaling, specifically by blocking NF-kappaB and NFAT promoter activities resulting in the loss of IL-2 secretion. The function may implicate its association with LCK proposed to impair phosphorylation of TCR subunits (By similarity). In contrast, shown to activate TCR-induced signaling in T-cells probably implicating ZAP70, LCP2, LCK and FYN (PubMed:21807895). Expressed on Treg cells can inhibit Th17 cell responses (By similarity). Receptor for LGALS9. Binding to LGALS9 is believed to result in suppression of T-cell responses; the resulting apoptosis of antigen-specific cells may implicate HAVCR2 phosphorylation and disruption of its association with BAG6 (PubMed:22863785). Binding to LGALS9 is proposed to be involved in innate immune response to intracellular pathogens. Expressed on Th1 cells interacts with LGALS9 expressed on Mycobacterium tuberculosis-infected macrophages to stimulate antibactericidal activity including IL-1 beta secretion and to restrict intracellular bacterial growth (PubMed:20937702). However, the function as receptor for LGALS9 has been challenged (By similarity). Also reported to enhance CD8+ T-cell responses to an acute infection such as by Listeria monocytogenes (PubMed:24567532). Receptor for phosphatidylserine (PtSer); PtSer-binding is calcium-dependent (PubMed:20083673). May recognize PtSer on apoptotic cells leading to their phagocytosis. Mediates the engulfment of apoptotic cells by dendritic cells (PubMed:19224762). Expressed on T-cells, promotes conjugation but not engulfment of apoptotic cells (PubMed:20083673). Expressed on dendritic cells (DCs) positively regulates innate immune response and in synergy with Toll-like receptors promotes secretion of TNF-alpha (PubMed:18006747). In tumor-imfiltrating DCs suppresses nucleic acid-mediated innate immune repsonse by interaction with HMGB1 and interfering with nucleic acid-sensing and trafficking of nucleid acids to endosomes (PubMed:22842346). Can enhance mast cell production of Th2 cytokines Il-4, IL-6 and IL-13 (PubMed:17620455). Expressed on natural killer (NK) cells acts as a coreceptor to enhance IFN-gamma production in response to LGALS9. In contrast, shown to suppress NK cell-mediated cytotoxicity (By similarity). Negatively regulates NK cell function in LPS-induced endotoxic shock (PubMed:25337993).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG227499 | Havcr2 (tGFP-tagged) - Mouse hepatitis A virus cellular receptor 2 (Havcr2), (10ug) |
CNY 5,200.00 |
|
| MR227499 | Havcr2 (Myc-DDK-tagged) - Mouse hepatitis A virus cellular receptor 2 (Havcr2) |
CNY 3,600.00 |
|
| MR227499L3 | Lenti ORF clone of Havcr2 (Myc-DDK-tagged) - Mouse hepatitis A virus cellular receptor 2 (Havcr2) |
CNY 6,000.00 |
|
| MR227499L4 | Lenti ORF clone of Havcr2 (mGFP-tagged) - Mouse hepatitis A virus cellular receptor 2 (Havcr2) |
CNY 6,000.00 |
