United States
Germany
Japan
United Kingdom
China
Gpr119 (NM_181751) Mouse Untagged Clone
CAT＃: MC213024
Gpr119 (untagged) - Mouse G-protein coupled receptor 119 (Gpr119), (10ug)
CNY 3,656.00
CNY 3,990.00
| Cited in 2 publications. |
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC213024 representing NM_181751
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Chromatograms |
CHROMATOGRAMS
 Sequencher program is needed, download here. |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_181751 |
| Insert Size | 1008 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_181751.2, NP_861416.1 |
| RefSeq Size | 2278 bp |
| RefSeq ORF | 1008 bp |
| Locus ID | 236781 |
| UniProt ID | Q7TQP3 |
| Gene Summary | Receptor for the endogenous fatty-acid ethanolamide oleoylethanolamide (OEA) and lysophosphatidylcholine (LPC). Functions as a glucose-dependent insulinotropic receptor. The activity of this receptor is mediated by G proteins which activate adenylate cyclase. Seems to act through a G(s) mediated pathway.[UniProtKB/Swiss-Prot Function] |
Citations (2)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
GPR119 agonist AS1269574 activates TRPA1 cation channels to stimulate GLP-1 secretion
,Chepurny, OG;Holz, GG;Roe, MW;Leech, CA;,
Mol. Endocrinol.
,PubMed ID 27082897
[Gpr119]
|
|
Stimulation of Proglucagon Gene Expression by Human GPR119 in Enteroendocrine L-cell Line GLUTag
,Oleg G. Chepurny, Daniela Bertinetti, Mandy Diskar, Colin A. Leech, Parisa Afshari, Tamara Tsalkova, Xiaodong Cheng, Frank Schwede, Hans-G. Genieser, Friedrich W. Herberg, and George G. Holz,
Mol. Endocrinol., Aug 2013; 27: 1267 - 1282.
,PubMed ID 23798572
[GPR119]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG224908 | Gpr119 (tGFP-tagged) - Mouse G-protein coupled receptor 119 (Gpr119), (10ug) |
CNY 3,140.00 |
|
| MR224908 | Gpr119 (Myc-DDK-tagged) - Mouse G-protein coupled receptor 119 (Gpr119) |
CNY 3,656.00 |
|
| MR224908L3 | Lenti ORF clone of Gpr119 (Myc-DDK-tagged) - Mouse G-protein coupled receptor 119 (Gpr119) |
CNY 4,750.00 |
|
| MR224908L4 | Lenti ORF clone of Gpr119 (mGFP-tagged) - Mouse G-protein coupled receptor 119 (Gpr119) |
CNY 6,056.00 |
