Ostn (NM_198112) Mouse Untagged Clone
CAT#: MC213087
Ostn (untagged) - Mouse osteocrin (Ostn), (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Ostc |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC213087 representing NM_198112
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTGGACTGGAGATTGGCAAGTACACACTTCATCCTGGCTATGATTGTGATGCTGTGGGGCTCAGGAA AGGCATTCTCTGTGGACTTAGCATCACAGGAGTTTGGAACAGCAAGCTTGCAGTCTCCACCCACAGCCAG AGAAGAGAAGTCAGCCACTGAGCTTTCGGCTAAGCTCCTGCGTCTTGATGATCTGGTGTCCTTAGAGAAT GACGTATTTGAGACCAAGAAAAAGAGAAGCTTCTCTGGCTTTGGGTCTCCCCTTGACAGACTCTCAGCTG GGTCTGTAGAGCATAGAGGGAAACAAAGGAAAGCAGTAGATCATTCAAAAAAGCGGTTTGGTATTCCCAT GGATCGGATTGGTAGAAACCGGCTCTCCAGTTCCAGAGGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_198112 |
Insert Size | 393 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_198112.2, NP_932780.1 |
RefSeq Size | 1268 bp |
RefSeq ORF | 393 bp |
Locus ID | 239790 |
UniProt ID | P61364 |
Gene Summary | Hormone that acts as a ligand for natriuretic peptide receptor NPR3/NPR-C and promotes bone growth and physical endurance in muscle. Acts as a regulator of osteoblast differentiation and bone growth by binding to natriuretic peptide receptor NPR3/NPR-C, thereby preventing binding between NPR3/NPR-C and natriuretic peptides, leading to increase cGMP production (PubMed:14523025, PubMed:17951249). Required to enhance physical endurance: induced following physical exercise in muscle and promotes cGMP production, probably by interacting with NPR3/NPR-C (PubMed:26668395). May act as an autocrine and paracrine factor linked to glucose metabolism in skeletal muscle (PubMed:15044443).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG215395 | Ostn (tGFP-tagged) - Mouse osteocrin (Ostn), (10ug) |
CNY 3,400.00 |
|
MR215395 | Ostn (Myc-DDK-tagged) - Mouse osteocrin (Ostn) |
CNY 1,800.00 |
|
MR215395L3 | Lenti ORF clone of Ostn (Myc-DDK-tagged) - Mouse osteocrin (Ostn) |
CNY 4,750.00 |
|
MR215395L4 | Lenti ORF clone of Ostn (mGFP-tagged) - Mouse osteocrin (Ostn) |
CNY 4,750.00 |