Kcnrg (NM_206974) Mouse Untagged Clone

CAT#: MC214525

Kcnrg (untagged) - Mouse potassium channel regulator (Kcnrg), transcript variant 2, (10ug)



  "NM_206974" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Clld4; E030012H22Rik; Gm745
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC214525 representing NM_206974
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGTGGTCAGGACCTCGTCACTTTGAATGTGGGAGGGAGGATATTCACAACAAGGCCCTCTACCCTCA
AGCAGTTCCCTGCCTCTCGCTTGGCAGGCATGTTAGATGGCAGAGACCAAGAGTTCAAGACAGTTGATGG
CCAGATTTTTGTGGACAGAGATGGTGCTTTATTTAGTTTCATTTTAGATTTTTTGAGAAATCATGAGCTT
CTGTTACCCTCGGACTTTGCAGACCATCATAGGCTTCAGAGAGAGGCTCTTTTCTATGAACTTGATTCTC
TTGTTGATCTCTTAAGCCAATTCCTGCTCCAATCAAGATCTGCTGTCATGGAGGTCCATTTCCTAAACCA
AAATACTCAAGCCTTCTTCAGAGTGTTTGGCTCTTGCAGCAAAACAATCGAGATGCTAAGTGGGAGGATT
ACAATGTTTGTAGAGCGACCCACAGCACTGACCGGGAACAGGAACTCCCCTCTGGCTTTACCTCCACAAA
GACCTTCTCACCACGATCTGCTTTTCCACTGTGGCTCCGATGGCGCTGCTGAGAACCAAGCTGGAGTCAG
GTATTTTGAATGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_206974
Insert Size 576 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_206974.1, NP_996857.1
RefSeq Size 1832 bp
RefSeq ORF 576 bp
Locus ID 328424
UniProt ID Q2TUM3
Gene Summary Inhibits potassium fluxes in cells. May regulate Kv1 family channel proteins by retaining a fraction of channels in endomembranes (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate splice site in the coding region, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...