Plb1 (NM_172147) Mouse Untagged Clone
CAT#: MC215360
Plb1 (untagged) - Mouse phospholipase B1 (Plb1), transcript variant 3, (10ug)
CNY 3,600.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 4632413E21Rik; 4930433E17Rik; 4930539A06Rik; BC033606 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC215360 representing NM_172147
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCAGGAGCTGAAGAAACTAAACTGGAACCTCCAGAGCGGCATCTCCGAGCTCTCCTATTGGCACCGGT ACATGGAGCGTGAGGACTTCGCAGTCACTGTGCAGCCTTTCTTCCGGAATACCTTTATCCCACTGAATGA GCGTGAGGGCCTGGACCTCACTTTCTTCTCTGAAGACTGTTTCTACTTCTCAGACCGTGGGCATGCTGAG ATGGCCATTGCCCTCTGGAATAACATGCTGGAACCAGTGGGCTGGAAGACATCCTCCAATAACTTCATAT ACAACAGAACCAAACTCAAGTGCCCCTCACCTGAAAGGCCTTTCCTCTACACCCTCCGGAATAGTCAGCT TCTTCCAGACAAGGCTGAAGAACCCTCCAATGCACTCTACTGGGCAGTGCCAGTGGCAGCAATAGGTGGC CTGGCAGTTGGCATCCTTGGAGTGATGTTGTGGAGAACTGTGAAACCCGTCCAACAGGAGGAGGAGGAGG AGGACACTCTTCCAAATACAAGTGTGACCCAGGATGCTGTATCAGAAAAGAGGCTCAAAGCTGGGAACTA G ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_172147 |
Insert Size | 561 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_172147.2, NP_742159.1 |
RefSeq Size | 763 bp |
RefSeq ORF | 561 bp |
Locus ID | 665270 |
Gene Summary | Membrane-associated phospholipase. Exhibits a calcium-independent broad substrate specificity including phospholipase A2/lysophospholipase activity. Preferential hydrolysis at the sn-2 position of diacylphospholipids and diacyglycerol, whereas it shows no positional specificity toward triacylglycerol. Exhibits also esterase activity toward p-nitrophenyl. May act on the brush border membrane to facilitate the absorption of digested lipids (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) contains only a small portion of the 3' end of variant 1 and uses a downstream start codon to encode a much shorter protein (isoform 3) when it is compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG215680 | Plb1 (tGFP-tagged) - Mouse phospholipase B1 (Plb1) transcript variant 3, (10ug) |
CNY 2,090.00 |
|
MR215680 | Plb1 (Myc-DDK-tagged) - Mouse phospholipase B1 (Plb1), transcript variant 3 |
CNY 1,900.00 |
|
MR215680L3 | Lenti ORF clone of Plb1 (Myc-DDK-tagged) - Mouse phospholipase B1 (Plb1), transcript variant 3 |
CNY 3,800.00 |
|
MR215680L4 | Lenti ORF clone of Plb1 (mGFP-tagged) - Mouse phospholipase B1 (Plb1), transcript variant 3 |
CNY 3,800.00 |