Tmsb15b2 (NM_001080967) Mouse Untagged Clone
CAT#: MC215457
Tmsb15b2 (untagged) - Mouse thymosin beta 15b2 (Tmsb15b2), (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Tb15c |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC215457 representing NM_001080967
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGCGATAAACCAGACTTGTCAGAAGTTGAAACATTTGACAAAGCAAAGTTGAAGAAAACTAATACTG AAGTAAAAAATACTCTTCCGTCGAAGGAAACTATCCAGCAAGAGAAAGAACACAATGAAAGAACATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001080967 |
Insert Size | 138 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001080967.4, NP_001074436.1 |
RefSeq Size | 691 bp |
RefSeq ORF | 138 bp |
Locus ID | 100034363 |
Gene Summary | This gene is part of tandem duplication; the other copy of this gene is about 1.5 kb away. Readthrough transcripts that include two exons transcribed from each gene exist. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG212266 | Tmsb15b2 (tGFP-tagged) - Mouse thymosin beta 15b2 (Tmsb15b2), (10ug) |
CNY 2,850.00 |
|
MR212266 | Tmsb15b2 (Myc-DDK-tagged) - Mouse thymosin beta 15b2 (Tmsb15b2) |
CNY 1,200.00 |
|
MR212266L3 | Lenti ORF clone of Tmsb15b2 (Myc-DDK-tagged) - Mouse thymosin beta 15b2 (Tmsb15b2) |
CNY 4,750.00 |
|
MR212266L4 | Lenti ORF clone of Tmsb15b2 (mGFP-tagged) - Mouse thymosin beta 15b2 (Tmsb15b2) |
CNY 4,750.00 |
其它Tmsb15b2产品