United States
Germany
Japan
United Kingdom
China
Acod1 (NM_008392) Mouse Untagged Clone
CAT＃: MC216802
Irg1 (untagged) - Mouse immunoresponsive gene 1 (Irg1), (10ug)
CNY 5,488.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AI323667; CAD; Irg1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_008392, the custom clone sequence may differ by one or more nucleotides
ATGATGCTCAAGTCTGTCACAGAGAGCTTTGCTGGTATGATTCACGGCTTGAAAGTGAACCACCTGACAG ATGGTATCATTCGGAGGAGCAAGAGGATGATCCTGGATTCTCTGGGCGTTGGCTTCCTGGGGACAGGCAC AGAAGTGTTCCATAAAGTCACCCAATATAGTAAAATCTACAGTTCCAACACCTCCAGCACTGTTTGGGGT CGACCAGACTTCAGGCTCCCACCGACATATGCTGCTTTTGTTAATGGTGTTGCTGTTCACTCCATGGATT TTGATGACACATGGCACCCTGCCACCCACCCTTCTGGGGCTGTCCTACCTGTCCTCACAGCTCTATCGGA AGCCCTGCCTCAGACTCCCAAGTTTTCTGGCCTCGACCTGCTGCTGGCGTTCAACGTTGGTATTGAAGTA CAGGGACGATTAATGCACTTCTCCAAGGAAGCCAAAGACATACCAAAGAGATTCCACCCTCCCTCTGTGG TGGGGACTCTGGGAAGTGCTGCTGCTGCGTCCAAGTTTCTGGGGCTCAGCTTGACAAAGTGCCGCGAGGC ATTGGCTATTGCTGTTTCCCACGCAGGGGCACCCATAGCGAACGCTGCCACTCAGACTAAGCCCCTTCAT ATTGGCAATGCAGCCAAGCATGGGATGGAAGCCACGTTTCTGGCAATGCTGGGCCTCCAAGGAAACAAAC AGATCTTGGACCTGGGGTCAGGGTTCGGTGCCTTCTATGCCAACTACTCCCCCGAAGACCTTCCAAGCCT GGATTCTCACATCTGGCTGTTGGACCAGCAGGATGTGGCCTTTAAGAGCTTCCCGGCACATCTGGCTACC CACTGGGTGGCAGATGCAGCTGCAGCCGTGAGAAAGCACCTTGTGACACCAGAAAGAGCCCTGTTCCCTG CTGACCACATCGAGAGAATCGTGCTCAGGATCCCTGACGTCCAGTACGTAAACAGGCCCTTCCCGGACTC AGAGCATGAAGCCCGTCATTCTTTCCAGTATGTGGCCTGTGCCTCGCTGCTCGACGGTAGCATCACTGTC CCATCCTTCCACAGCCAGCAGGTCAATAGGCCTCAGGTGAGAGAGTTGCTCAAGAAGGTGAAGCTGGAGC ATCCTCCTGACAACCCGCCAAGCTTCGACACGCTATACTGTGAAATAAGCATCACTCTAAAGGACGGGAC CACTTTCACCGAGCGCTCTGACACCTTCTATGGTCACTGGAGGAAACCACTGAGCCAGGAAGATCTGCGC AACAAGTTCCGAGCCAATGCCTCAAAGATGCTATGCAGGGACACGGTGGAAAGCCTTATAACGGTAGTAG AAAAGCTAGAAGACCTAGAAGACTGCTCTGTGCTAACCAGACTTCTGAAAGGACCCTCTGTCCAAGATGA AGCTTCAAAACTATCCAGCATGTCCTCATTCGATCACACAACGTTGCCCAGGTTTACCAATATCTAA |
| Chromatograms |
CHROMATOGRAMS
 Sequencher program is needed, download here. |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_008392 |
| Insert Size | 1467 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_008392.1, NP_032418.1 |
| RefSeq Size | 2588 bp |
| RefSeq ORF | 1467 bp |
| Locus ID | 16365 |
| UniProt ID | P54987 |
| Gene Summary | Involved in the inhibition of the inflammatory response. Acts as a negative regulator of the Toll-like receptors (TLRs)-mediated inflammatory innate response by stimulating the tumor necrosis factor alpha-induced protein TNFAIP3 expression via reactive oxygen species (ROS) in LPS-tolerized macrophages. Involved in antimicrobial response of innate immune cells; ACOD1-mediated itaconic acid production contributes to the antimicrobial activity of macrophages. Plays a role in the embryo implantation.[UniProtKB/Swiss-Prot Function] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Immune-responsive gene 1 protein links metabolism to immunity by catalyzing itaconic acid production
,Alessandro Michelucci, Thekla Cordes, Jenny Ghelfi, Arnaud Pailot, Norbert Reiling, Oliver Goldmann, Tina Binz, André Wegner, Aravind Tallam, Antonio Rausell, Manuel Buttini, Carole L. Linster, Eva Medina, Rudi Balling, and Karsten Hiller,
PNAS, May 2013; 110: 7820 - 7825.
,PubMed ID 23610393
[Acod1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG217265 | Irg1 (tGFP-tagged) - Mouse immunoresponsive gene 1 (Irg1), (10ug) |
CNY 7,088.00 |
|
| MR217265 | Irg1 (Myc-DDK-tagged) - Mouse immunoresponsive gene 1 (Irg1) |
CNY 5,488.00 |
|
| MR217265L3 | Lenti ORF clone of Irg1 (Myc-DDK-tagged) - Mouse immunoresponsive gene 1 (Irg1) |
CNY 7,888.00 |
|
| MR217265L4 | Lenti ORF clone of Irg1 (mGFP-tagged) - Mouse immunoresponsive gene 1 (Irg1) |
CNY 7,888.00 |
