Egr1 (NM_007913) Mouse Untagged Clone

CAT#: MC217560

Egr1 (untagged) - Mouse early growth response 1 (Egr1), (10ug)



  "NM_007913" in other vectors (4)

CNY 3,976.00

CNY 6,840.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-EGR1 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms A530045N19Rik; egr; Egr-1; ETR103; Krox-1; Krox-24; Krox24; NGF1-A; NGFI-A; NGFIA; TIS8; Zenk; Zfp-6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_007913, the custom clone sequence may differ by one or more nucleotides


ATGGCAGCGGCCAAGGCCGAGATGCAATTGATGTCTCCGCTGCAGATCTCTGACCCGTTCGGCTCCTTTC
CTCACTCACCCACCATGGACAACTACCCCAAACTGGAGGAGATGATGCTGCTGAGCAACGGGGCTCCCCA
GTTCCTCGGTGCTGCCGGAACCCCAGAGGGCAGCGGCGGTAATAGCAGCAGCAGCACCAGCAGCGGGGGC
GGTGGTGGGGGCGGCAGCAACAGCGGCAGCAGCGCCTTCAATCCTCAAGGGGAGCCGAGCGAACAACCCT
ATGAGCACCTGACCACAGAGTCCTTTTCTGACATCGCTCTGAATAATGAGAAGGCGATGGTGGAGACGAG
TTATCCCAGCCAAACGACTCGGTTGCCTCCCATCACCTATACTGGCCGCTTCTCCCTGGAGCCCGCACCC
AACAGTGGCAACACTTTGTGGCCTGAACCCCTTTTCAGCCTAGTCAGTGGCCTCGTGAGCATGACCAATC
CTCCGACCTCTTCATCCTCGGCGCCTTCTCCAGCTGCTTCATCGTCTTCCTCTGCCTCCCAGAGCCCGCC
CCTGAGCTGTGCCGTGCCGTCCAACGACAGCAGTCCCATCTACTCGGCTGCGCCCACCTTTCCTACTCCC
AACACTGACATTTTTCCTGAGCCCCAAAGCCAGGCCTTTCCTGGCTCGGCAGGCACAGCCTTGCAGTACC
CGCCTCCTGCCTACCCTGCCACCAAAGGTGGTTTCCAGGTTCCCATGATCCCTGACTATCTGTTTCCACA
ACAACAGGGAGACCTGAGCCTGGGCACCCCAGACCAGAAGCCCTTCCAGGGTCTGGAGAACCGTACCCAG
CAGCCTTCGCTCACTCCACTATCCACTATTAAAGCCTTCGCCACTCAGTCGGGCTCCCAGGACTTAAAGG
CTCTTAATACCACCTACCAATCCCAGCTCATCAAACCCAGCCGCATGCGCAAGTACCCCAACCGGCCCAG
CAAGACACCCCCCCATGAACGCCCATATGCTTGCCCTGTCGAGTCCTGCGATCGCCGCTTTTCTCGCTCG
GATGAGCTTACCCGCCATATCCGCATCCACACAGGCCAGAAGCCCTTCCAGTGTCGAATCTGCATGCGTA
ACTTCAGTCGTAGTGACCACCTTACCACCCACATCCGCACCCACACAGGCGAGAAGCCTTTTGCCTGTGA
CATTTGTGGGAGGAAGTTTGCCAGGAGTGATGAACGCAAGAGGCATACCAAAATCCATTTAAGACAGAAG
GACAAGAAAGCAGACAAAAGTGTGGTGGCCTCCCCGGCTGCCTCTTCACTCTCTTCTTACCCATCCCCAG
TGGCTACCTCCTACCCATCCCCTGCCACCACCTCATTCCCATCCCCTGTGCCCACTTCCTACTCCTCTCC
TGGCTCCTCCACCTACCCATCTCCTGCGCACAGTGGCTTCCCGTCGCCGTCAGTGGCCACCACCTTTGCC
TCCGTTCCACCTGCTTTCCCCACCCAGGTCAGCAGCTTCCCGTCTGCGGGCGTCAGCAGCTCCTTCAGCA
CCTCAACTGGTCTTTCAGACATGACAGCGACCTTTTCTCCCAGGACAATTGAAATTTGCTAA


Restriction Sites AscI-MluI     
ACCN NM_007913
Insert Size 1602 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC138613, AAI38614
RefSeq Size 1978 bp
RefSeq ORF 1602 bp
Locus ID 13653
UniProt ID P08046
Gene Summary Transcriptional regulator (PubMed:8336701, PubMed:8703054, PubMed:15958557). Recognizes and binds to the DNA sequence 5'-GCG(T/G)GGGCG-3'(EGR-site) in the promoter region of target genes (PubMed:8703054, PubMed:15958557, PubMed:2028256, PubMed:8939742). Binds double-stranded target DNA, irrespective of the cytosine methylation status (By similarity). Regulates the transcription of numerous target genes, and thereby plays an important role in regulating the response to growth factors, DNA damage, and ischemia (PubMed:11100120, PubMed:15958557). Plays a role in the regulation of cell survival, proliferation and cell death (PubMed:15265859, PubMed:15958557). Activates expression of p53/TP53 and TGFB1, and thereby helps prevent tumor formation (PubMed:15958557). Required for normal progress through mitosis and normal proliferation of hepatocytes after partial hepatectomy (PubMed:15265859). Mediates responses to ischemia and hypoxia; regulates the expression of proteins such as IL1B and CXCL2 that are involved in inflammatory processes and development of tissue damage after ischemia (PubMed:11100120). Regulates biosynthesis of luteinizing hormone (LHB) in the pituitary (PubMed:8703054). Regulates the amplitude of the expression rhythms of clock genes: ARNTL/BMAL1, PER2 and NR1D1 in the liver via the activation of PER1 (clock repressor) transcription (PubMed:26471974). Regulates the rhythmic expression of core-clock gene ARNTL/BMAL1 in the suprachiasmatic nucleus (SCN) (PubMed:29138967).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...