Usf1 (BC049784) Mouse Untagged Clone

CAT#: MC218268

Usf1 (untagged) - Mouse upstream transcription factor 1 (cDNA clone MGC:59374 IMAGE:6506829), (10ug)



  "BC049784" in other vectors (4)

CNY 6,940.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms bHLHb11
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC049784
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGGGGCAGCAGAAAACAGCTGAAACCGAAGAGGGAACAGTGCAGATTCAGGAAGGCGCAGTGGCTA
CTGGAGAGGACCCAACTAGTGTAGCTATCGCCAGCATCCAGTCAGCTGCCACTTTTCCTGACCCCAACGT
CAAGTACGTCTTCCGAACTGAGAATGGGGGCCAGGTGATGTACAGGGTGATCCAGGTGTCAGAGGGGCAG
CTGGATGGCCAGACAGAGGGCTCTGGCGCCATCAGTGGTTACCCTGCCACTCAGTCTATGACCCAGGCAG
TGATCCAGGGAGCTTTCACCAGTGACGATGCCGTTGACACGGAGGGAGCAGCTGCTGAGACACATTATAC
ATATTTCCCCAGCACCGCAGTGGGAGATGGGTCAGGGGGCACCACATCTGGGAGTACAACAGCTGTTGTT
ACCACCCAGGGCTCAGAGGCACTACTGGGGCAGGCAACCCCGCCCAGCACAGGTCAATTCTTTGTGATGA
TGTCACCACAAGAAGTATTGCAGGGAGGGTGCCAGCGATCGATTGCCCCCAGGACCCACCCTTATTCCCC
GAAGTCAGAGGCTCCCAGGACAACACGAGATGAGAAACGGAGGGCTCAACATAACGAAGTGGAGCGCCGC
CGCCGGGACAAGATCAACAACTGGATTGTACAGCTGTCCAAAATCATCCCAGACTGCTCTATGGAGAGCA
CCAAGTCTGGCCAGAGTAAAGGTGGAATCCTGTCCAAAGCCTGTGATTATATCCAGGAGCTGCGGCAGAG
CAACCACCGGCTGTCTGAAGAGCTGCAGGGGTTAGATCAGTTGCAGCTGGACAACGATGTGCTCCGGCAA
CAGGTCAGACTAACTCCAGGATGGCCCCCTTGGCAGCCCCGTAGCCACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
ACCN BC049784
Insert Size 891 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC049784, AAH49784
RefSeq Size 1926 bp
RefSeq ORF 890 bp
Locus ID 22278
Gene Summary This protein encoded by this gene is a member of the basic-Helix-Hoop-Helix-Leucine zipper (bHLH-LZ) family and encodes a protein that can act as a transcription factor. Studies indicate that the basic region interacts with DNA at E-Box motifs, while the helix-loop-helix and leucine zipper domains are involved in dimerization with different partners. This protein is involved in a wide array of biological pathways, including cell cycle regulation, immune response, and responses to ultraviolet radiation. Mice lacking most of the coding exons of this gene often lacked both whiskers and nasal fur, and were prone to epileptic seizures, while mice lacking both this gene and another family member, Usf2, displayed embryonic lethality (PMID:9520440). Mutations in the human ortholog of this gene have been associated with Familial Combined Hyperlipidemia (FCHL) in humans. Pseudogenes of this gene are found on chromosome 11 and the X chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...