Dll1 (NM_007865) Mouse Untagged Clone

CAT#: MC221075

Dll1 (untagged) - Mouse delta-like 1 (Drosophila) (Dll1), (10ug)



  "NM_007865" in other vectors (6)

CNY 8,472.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Delta1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC221075 representing NM_007865
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGCCGTCGGAGCGCGCTAGCCCTTGCCGTGGTCTCTGCCCTGCTGTGCCAGGTCTGGAGCTCCGGCG
TATTTGAGCTGAAGCTGCAGGAGTTCGTCAACAAGAAGGGGCTGCTGGGGAACCGCAACTGCTGCCGCGG
GGGCTCTGGCCCGCCTTGCGCCTGCAGGACCTTCTTTCGCGTATGCCTCAAGCACTACCAGGCCAGCGTG
TCACCGGAGCCACCCTGCACCTACGGCAGTGCTGTCACGCCAGTGCTGGGTGTCGACTCCTTCAGCCTGC
CTGATGGCGCAGGCATCGACCCCGCCTTCAGCAACCCCATCCGATTCCCCTTCGGCTTCACCTGGCCAGG
TACCTTCTCTCTGATCATTGAAGCCCTCCATACAGACTCTCCCGATGACCTCGCAACAGAAAACCCAGAA
AGACTCATCAGCCGCCTGACCACACAGAGGCACCTCACTGTGGGAGAAGAATGGTCTCAGGACCTTCACA
GTAGCGGCCGCACAGACCTCCGGTACTCTTACCGGTTTGTGTGTGACGAGCACTACTACGGAGAAGGTTG
CTCTGTGTTCTGCCGACCTCGGGATGACGCCTTTGGCCACTTCACCTGCGGGGACAGAGGGGAGAAGATG
TGCGACCCTGGCTGGAAAGGCCAGTACTGCACTGACCCAATCTGTCTGCCAGGGTGTGATGACCAACATG
GATACTGTGACAAACCAGGGGAGTGCAAGTGCAGAGTTGGCTGGCAGGGCCGCTACTGCGATGAGTGCAT
CCGATACCCAGGTTGTCTCCATGGCACCTGCCAGCAACCCTGGCAGTGTAACTGCCAGGAAGGCTGGGGG
GGCCTTTTCTGCAACCAAGACCTGAACTACTGTACTCACCATAAGCCGTGCAGGAATGGAGCCACCTGCA
CCAACACGGGCCAGGGGAGCTACACATGTTCCTGCCGACCTGGGTATACAGGTGCCAACTGTGAGCTGGA
AGTAGATGAGTGTGCTCCTAGCCCCTGCAAGAACGGAGCGAGCTGCACGGACCTTGAGGACAGCTTCTCT
TGCACCTGCCCTCCCGGCTTCTATGGCAAGGTCTGTGAGCTGAGCGCCATGACCTGTGCAGATGGCCCTT
GCTTCAATGGAGGACGATGTTCAGATAACCCTGACGGAGGCTACACCTGCCATTGCCCCTTGGGCTTCTC
TGGCTTCAACTGTGAGAAGAAGATGGATCTCTGCGGCTCTTCCCCTTGTTCTAACGGTGCCAAGTGTGTG
GACCTCGGCAACTCTTACCTGTGCCGGTGCCAGGCTGGCTTCTCCGGGAGGTACTGCGAGGACAATGTGG
ATGACTGTGCCTCCTCCCCGTGTGCAAATGGGGGCACCTGCCGGGACAGTGTGAACGACTTCTCCTGTAC
CTGCCCACCTGGCTACACGGGCAAGAACTGCAGCGCCCCTGTCAGCAGGTGTGAGCATGCACCCTGCCAT
AATGGGGCCACCTGCCACCAGAGGGGCCAGCGCTACATGTGTGAGTGCGCCCAGGGCTATGGCGGCCCCA
ACTGCCAGTTTCTGCTCCCTGAGCCACCACCAGGGCCCATGGTGGTGGACCTCAGTGAGAGGCATATGGA
GAGCCAGGGCGGGCCCTTCCCCTGGGTGGCCGTGTGTGCCGGGGTGGTGCTTGTCCTCCTGCTGCTGCTG
GGCTGTGCTGCTGTGGTGGTCTGCGTCCGGCTGAAGCTACAGAAACACCAGCCTCCACCTGAACCCTGTG
GGGGAGAGACAGAAACCATGAACAACCTAGCCAATTGCCAGCGCGAGAAGGACGTTTCTGTTAGCATCAT
TGGGGCTACCCAGATCAAGAACACCAACAAGAAGGCGGACTTTCACGGGGACCATGGAGCCGAGAAGAGC
AGCTTTAAGGTCCGATACCCCACTGTGGACTATAACCTCGTTCGAGACCTCAAGGGAGATGAAGCCACGG
TCAGGGATACACACAGCAAACGTGACACCAAGTGCCAGTCACAGAGCTCTGCAGGAGAAGAGAAGATCGC
CCCAACACTTAGGGGTGGGGAGATTCCTGACAGAAAAAGGCCAGAGTCTGTCTACTCTACTTCAAAGGAC
ACCAAGTACCAGTCGGTGTATGTTCTGTCTGCAGAAAAGGATGAGTGTGTTATAGCGACTGAGGTGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_007865
Insert Size 2169 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_007865.3, NP_031891.2
RefSeq Size 3444 bp
RefSeq ORF 2169 bp
Locus ID 13388
UniProt ID Q61483
Gene Summary Transmembrane ligand protein of NOTCH1, NOTCH2 and NOTCH3 receptors that binds the extracellular domain (ECD) of Notch receptor in a cis and trans fashion manner (PubMed:21985982, PubMed:10958687). Following transinteraction, ligand cells produce mechanical force that depends of a clathrin-mediated endocytosis, requiring ligand ubiquitination, EPN1 interaction, and actin polymerisation; these events promote Notch receptor extracellular domain (NECD) transendocytosis and triggers Notch signaling through induction of cleavage, hyperphosphorylation, and nuclear accumulation of the intracellular domain of Notch receptors (NICD) (PubMed:10958687, PubMed:18676613). Is required for embryonic development and maintenance of adult stem cells in many different tissues and immune systeme; the DLL1-induced Notch signaling is mediated through an intercellular communication that regulates cell lineage, cell specification, cell patterning and morphogenesis through effects on differentiation and proliferation (PubMed:17194759, PubMed:19562077, PubMed:18997111, PubMed:23695674, PubMed:16495313, PubMed:21238454, PubMed:22282195, PubMed:7671806, PubMed:17960184, PubMed:22529374, PubMed:19389377, PubMed:23699523, PubMed:19144989, PubMed:23688253, PubMed:23806616, PubMed:26114479, PubMed:22940113, PubMed:25220152, PubMed:20081190, PubMed:21572390, PubMed:22096075). Plays a role in brain development at different level, namely by regulating neuronal differentiation of neural precursor cells via cell-cell interaction, most likely through the lateral inhibitory system in an endogenous level dependent-manner (PubMed:7671806, PubMed:18997111). During neocortex development, Dll1-Notch signaling transmission is mediated by dynamic interactions between intermediate neurogenic progenitors and radial glia; the cell-cell interactions are mediated via dynamic and transient elongation processes, likely to reactivate/maintain Notch activity in neighboring progenitors, and coordinate progenitor cell division and differentiation across radial and zonal boundaries (PubMed:23699523). During cerebellar development, regulates Bergmann glial monolayer formation and its morphological maturation through a Notch signaling pathway (PubMed:23688253). At the retina and spinal cord level, regulates neurogenesis by preventing the premature differentiation of neural progenitors and also by maintaining progenitors in spinal cord through Notch signaling pathway (PubMed:19389377, PubMed:26114479). Also controls neurogenesis of the neural tube in a progenitor domain-specific fashion along the dorsoventral axis (PubMed:20081190). Maintains quiescence of neural stem cells and plays a role as a fate determinant that segregates asymmetrically to one daughter cell during neural stem cells mitosis, resulting in neuronal differentiation in Dll1-inheriting cell (PubMed:23695674). Plays a role in immune systeme development, namely the development of all T-cells and marginal zone (MZ) B cells (PubMed:15146182, PubMed:19217325). Blocks the differentiation of progenitor cells into the B-cell lineage while promoting the emergence of a population of cells with the characteristics of a T-cell/NK-cell precursor (By similarity). Upon MMP14 cleavage, negatively regulates Notch signaling in haematopoietic progenitor cells to specifically maintain normal B-cell development in bone marrow (PubMed:21572390). Also plays a role during muscle development. During early development, inhibits myoblasts differentiation from the medial dermomyotomal lip and later regulates progenitor cell differentiation (PubMed:17194759). Directly modulates cell adhesion and basal lamina formation in satellite cells through Notch signaling. Maintains myogenic progenitors pool by suppressing differentiation through down-regulation of MYOD1 and is required for satellite cell homing and PAX7 expression (PubMed:22940113). During craniofacial and trunk myogenesis suppresses differentiation of cranial mesoderm-derived and somite-derived muscle via MYOD1 regulation but in cranial mes
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...