Sumo3 (NM_001301672) Mouse Untagged Clone

Specifications

Product Data
Type	Mouse Untagged Clone
Tag	Tag Free
Synonyms	2810014B19Rik; D10Ertd345; D10Ertd345e; SMT; SMT3A; Smt3h; Smt3h1; SUMO-3
Vector	pCMV6-Entry
E. coli Selection	Kanamycin (25 ug/mL)
Mammalian Cell Selection	Neomycin
Sequence Data	Fully Sequenced ORF (showhide) >MC225609 representing NM_001301672 Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCGGAAGAGAAGCCCAAGGAGGGTGTGAAGACAGAGAATGACCACATCAACCTGAAAGTGGCGGGGC AGGATGGCTCGGTGGTACAGTTCAAGATCAAGAGGCACACCCCACTGAGCAAGCTGATGAAGGCCTACTG TGAGAGGCAGGGCTTGTCAATGAGGCAGATTCGATTCCGGTTTGATGGACAACCAATCAATGAAACAGAC ACTCCAGCCCAGCAGACAGGAGGATCAGCCTCCCGAGGGAGCGTCCCCACACCCAACCGTTGTCCTGACC TGTGCTATTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites	SgfI-MluI
ACCN	NM_001301672
Insert Size	291 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation	Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001301672.1, NP_001288601.1
RefSeq Size	2588 bp
RefSeq ORF	291 bp
Locus ID	20610
UniProt ID	Q9Z172
Gene Summary	This gene encodes a member of the small ubiquitin-like modifier family. The encoded protein may regulate a variety of proteins in many pathways via a post-translational modification, known as SUMOylation. This activity may play a role in a wide variety of cellular processes, including nuclear transport, DNA replication and repair, mitosis, transcriptional regulation, and signal transduction. Disruption of some of these processes has been associated with cerebral ischemia, neural dysfunction, and heart disease. A pseudogene of this gene has been defined on the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014] Transcript Variant: This variant (3) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform 3), compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.