Fkbp1a (NM_001302079) Mouse Untagged Clone

CAT#: MC225638

Fkbp1a (untagged) - Mouse FK506 binding protein 1a (Fkbp1a), transcript variant 5



  "NM_001302079" in other vectors (1)

CNY 2,000.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Fkb; Fkbp; Fkbp1; FKBP12
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225638 representing NM_001302079
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAAGGAATATTGAAATACATCTTGGCAAGAACAGACTCTTCTCATGGACCAAATCGCAGTAGCTGTT
GTGGGATGCTTGAAGATGGAAAGAAATTTGATTCCTCTCGGGACAGAAACAAGCCTTTTAAGTTTACACT
AGGCAAGCAGGAGGTGATCCGAGGCTGGGAGGAAGGGGTAGCCCAGATGAGTGTGGGTCAGAGAGCCAAA
CTGATAATCTCCTCAGACTATGCCTATGGAGCCACCGGGCACCCAGGCATCATCCCACCACATGCCACTC
TTGTTTTTGATGTGGAGCTTCTAAAACTGGAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001302079
Insert Size 315 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001302079.1, NP_001289008.1
RefSeq Size 1795 bp
RefSeq ORF 315 bp
Locus ID 14225
UniProt ID P26883
Gene Summary This gene is a member of the immunophilin family. The encoded protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin, and is associated with immunoregulation, protein folding, receptor signaling, protein trafficking and T-cell activation. It may modulate the calcium release activity of the ryanodine receptor Ryr1. It also interacts with the type I TGF-beta receptor. Disruption of this gene in mouse causes severe ventricular defects. Pseudogenes of this gene have been defined on chromosomes 4, 10, 14, and 16. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Transcript Variant: This variant (5) contains an alternate exon in the 5' region and uses an alternate start codon compared to variant 1. It encodes isoform 3 which has a distinct N-terminus and is shorter than isoform 1. Variants 5 and 6 both encode the same isoform (3).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...