Sumo3 (NM_001301671) Mouse Untagged Clone

CAT#: MC225682

Sumo3 (untagged) - Mouse SMT3 suppressor of mif two 3 homolog 3 (yeast) (Sumo3), transcript variant 2



  "NM_001301671" in other vectors (1)

CNY 2,000.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2810014B19Rik; D10Ertd345; D10Ertd345e; SMT; SMT3A; Smt3h; Smt3h1; SUMO-3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225682 representing NM_001301671
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACCACTGTGTTGGCTCAGGAGGGTGTGAAGACAGAGAATGACCACATCAACCTGAAAGTGGCGGGGC
AGGATGGCTCGGTGGTACAGTTCAAGATCAAGAGGCACACCCCACTGAGCAAGCTGATGAAGGCCTACTG
TGAGAGGCAGGGCTTGTCAATGAGGCAGATTCGATTCCGGTTTGATGGACAACCAATCAATGAAACAGAC
ACTCCAGCCCAGCTGGAGATGGAGGATGAGGACACCATTGATGTATTCCAGCAGCAGACAGGAGGATCAG
CCTCCCGAGGGAGCGTCCCCACACCCAACCGTTGTCCTGACCTGTGCTATTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001301671
Insert Size 333 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001301671.1, NP_001288600.1
RefSeq Size 2756 bp
RefSeq ORF 333 bp
Locus ID 20610
UniProt ID Q9Z172
Gene Summary This gene encodes a member of the small ubiquitin-like modifier family. The encoded protein may regulate a variety of proteins in many pathways via a post-translational modification, known as SUMOylation. This activity may play a role in a wide variety of cellular processes, including nuclear transport, DNA replication and repair, mitosis, transcriptional regulation, and signal transduction. Disruption of some of these processes has been associated with cerebral ischemia, neural dysfunction, and heart disease. A pseudogene of this gene has been defined on the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Transcript Variant: This variant (2) differs in the 5' UTR and 5' coding region, compared to variant 1. The encoded isoform (2) is the same length as isoform 1, but contains a distinct N-terminus.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...