Azi2 (NM_001286507) Mouse Untagged Clone

CAT#: MC225905

Azi2 (untagged) - Mouse 5-azacytidine induced gene 2 (Azi2), transcript variant 3



  "NM_001286507" in other vectors (1)

CNY 2,000.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AA410145; AZ2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225905 representing NM_001286507
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATGAGGAATTTAAACCCACCCTCATCCAGCTGGGAGGTGGAGAAGCTAAGCTGTGACTTGAAGATCC
ATGGTTTGGAGCAAGAGCTGGGACTACTGAGGAAGGAGTGCAGTGACCTCAGGACAGAGCTGCAGAAGGC
CAGACAGACGGGTCCACCTCAGGAAGACATTCTGCAGGGCAGAGATGTCATCAGGCCGAGCTTGTCGAGA
GAAGAGCATGTTCCACACCAGGGTCTTCACCACAGTGATAATATGCAACATGCATACTGGGAACTGAAGA
GGGAGATGTCTAACTTACACCTGGTGACTCAAGTGCAAGCAGAACTACTAAGAAAACTGAAAACCTCAGC
TGCAGTCAAGAAAGGTTGTCAACTCATCCACACCGAGAATCCACTAAAATCCAAACAGCTGGGCACACCT
GGGAGCCATGTTTCTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001286507
Insert Size 438 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001286507.1, NP_001273436.1
RefSeq Size 1911 bp
RefSeq ORF 438 bp
Locus ID 27215
UniProt ID Q9QYP6
Gene Summary Adapter protein which binds TBK1 and IKBKE playing a role in antiviral innate immunity. Activates serine/threonine-protein kinase TBK1 and facilitates its oligomerization. Enhances the phosphorylation of NF-kappa-B p65 subunit RELA by TBK1. Promotes TBK1-induced as well as TNF-alpha or PMA-induced activation of NF-kappa-B. Participates in IFNB promoter activation via TICAM1.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in both UTR's and the coding region but maintains the reading frame, compared to variant 1. This results in a protein that has shorter N-terminus and distinct C-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...