Vamp7 (NM_001302138) Mouse Untagged Clone

CAT#: MC226116

Vamp7 (untagged) - Mouse vesicle-associated membrane protein 7 (Vamp7), transcript variant 2



  "NM_001302138" in other vectors (1)

CNY 2,000.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Vamp7 Antibody - C-terminal region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Sybl1; TI-VAMP; VAMP-7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226116 representing NM_001302138
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTTGGTGTGGAGGAAACTTCCTGGAGTTATTTGTTTCATTACATCTGCCAAGACAGGATTGTGTATC
TTTGTATCACTGATGATGATTTTGAGCGTTCTCGAGCGTTCAGTTTTTTGAATGAAGTAAAGAAGAGATT
CCAGACAACTTACGGTTCAAGAGCACAAACTGCACTTCCTTATGCTATGAATAGCGAGTTTTCAAGTGTT
TTGGCTGCACAACTGAAGCATCACTCTGAGAATAAGAGCCTAGACAAAGTGATGGAGACTCAAGCACAAG
TGGATGAACTGAAAGGAATAATGGTCAGAAACATAGATTTAGTTGCTCAACGTGGAGAAAGGTTGGAATT
GCTGATAGATAAAACAGAAAACCTTGTGGATTCATCTGTCACTTTCAAAACTACCAGCAGAAATCTTGCT
CGAGCCATGTGTATGAAGAATATCAAGCTCACTATCATCATCATCATTGTATCAATTGTGTTCATCTATA
TCATTGTGTCACTTCTCTGTGGTGGGTTTACATGGCCAAACTGTGTGAAGAAATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001302138
Insert Size 546 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001302138.1, NP_001289067.1
RefSeq Size 2530 bp
RefSeq ORF 546 bp
Locus ID 20955
UniProt ID P70280
Gene Summary Involved in the targeting and/or fusion of transport vesicles to their target membrane during transport of proteins from the early endosome to the lysosome. Required for heterotypic fusion of late endosomes with lysosomes and homotypic lysosomal fusion. Required for calcium regulated lysosomal exocytosis. Involved in the export of chylomicrons from the endoplasmic reticulum to the cis Golgi. Required for exocytosis of mediators during eosinophil and neutrophil degranulation, and target cell killing by natural killer cells. Required for focal exocytosis of late endocytic vesicles during phagosome formation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate splice site in the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The resulting isoform (2) has a shorter and distinct N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...