Ube2w (NM_001271016) Mouse Untagged Clone

CAT#: MC226129

Ube2w (untagged) - Mouse ubiquitin-conjugating enzyme E2W (putative) (Ube2w), transcript variant 2



  "NM_001271016" in other vectors (1)

CNY 2,000.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 6130401J04Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226129 representing NM_001271016
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTGGGCCCCCGCGGCGTGACGCGAGCACGGCGGCTCCGCCCCCTGCGTCTCGGGCCTCGCTGGCCTT
GGGGGGATGGTTTCATCATGGCGTCAATGCAGAAACGACTACAAAAAGAACTGTTGGCTTTGCAGAATGA
CCCACCTCCTGGAATGACTTTAAATGAAAAGAGTGTTCAGAATTCAATCACGCAGTGGATCGTAGACATG
GAAGGTGCACCAGGAACCTTATATGAAGGGGAAAAATTTCAACTTTTGTTTAAATTTAGTAGTCGATACC
CTTTTGACTCTCCTCAGAAGACTGGTCCCCGGCGCTCTCAGTGCAGTCAGTCTGTCTCAGCATTATCAGC
ATGCTTTCCAGCTGCAAAGAAAAGAGACGACCACCAGATAATTCCTTTTATGTGCGAACATGTAACAAGA
ATCCAAAGAAAACAAAATGGTGGTATCATGGTGGATACAGTGCCCGTGGAGGCCAGAAGAGGGACTCTTA
CCCACTGGAACTGGAGTTTAAAGATAGTTGTGTGCTGTCATGTGAGTTCTATGGTCACCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001271016
Insert Size 552 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271016.1, NP_001257945.1
RefSeq Size 1551 bp
RefSeq ORF 552 bp
Locus ID 66799
Gene Summary Accepts ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins. Specifically monoubiquitinates the N-terminus of various substrates, including ATXN3, MAPT/TAU, POLR2H/RPB8 and STUB1/CHIP, by recognizing backbone atoms of disordered N-termini (PubMed:21855799, PubMed:21229326). Involved in degradation of misfolded chaperone substrates by mediating monoubiquitination of STUB1/CHIP, leading to recruitment of ATXN3 to monoubiquitinated STUB1/CHIP, and restriction of the length of ubiquitin chain attached to STUB1/CHIP substrates by ATXN3 (PubMed:21855799). After UV irradiation, but not after mitomycin-C (MMC) treatment, acts as a specific E2 ubiquitin-conjugating enzyme for the Fanconi anemia complex by associating with E3 ubiquitin-protein ligase FANCL and catalyzing monoubiquitination of FANCD2, a key step in the DNA damage pathway (PubMed:21229326). In vitro catalyzes 'Lys-11'-linked polyubiquitination. UBE2W-catalyzed ubiquitination occurs also in the presence of inactive RING/U-box type E3s, i.e. lacking the active site cysteine residues to form thioester bonds with ubiquitin, or even in the absence of E3, albeit at a slower rate (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate splice site and has alternate 3' exon structure, and it thus differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (2) has a distinct and longer C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...