Fgf13 (NM_001290415) Mouse Untagged Clone

CAT#: MC226197

Fgf13 (untagged) - Mouse fibroblast growth factor 13 (Fgf13), transcript variant 3



  "NM_001290415" in other vectors (1)

CNY 2,000.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Goat Anti-FGF13 (isoform 1) Antibody
    • 100 ug

CNY 5,371.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Fhf2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226197 representing NM_001290415
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTTTGTTAAGGAAGTCATATTCAGAGCCTCAGCTTAAGGGTATAGTTACCAAACTATACAGCCGAC
AAGGCTACCACTTGCAACTGCAGGCAGATGGAACCATTGATGGCACCAAAGACGAGGACAGCACTTACAC
TCTGTTTAACCTCATCCCTGTGGGTCTTCGGGTGGTGGCTATTCAAGGAGTTCAAACCAAGCTGTATTTG
GCAATGAACAGCGAGGGATACTTGTACACCTCGGAACATTTCACACCTGAGTGCAAATTCAAAGAATCAG
TGTTTGAAAATTATTACGTGACATACTCATCAATGATCTACCGTCAGCAGCAATCCGGCCGAGGGTGGTA
TCTAGGTCTGAACAAAGAAGGAGAGATCATGAAAGGCAACCATGTGAAGAAGAACAAGCCTGCAGCACAT
TTTCTGCCCAAACCACTGAAAGTGGCCATGTACAAGGAGCCATCTCTGCACGATCTCACGGAGTTCTCCC
GATCTGGAAGTGGGACCCCGACCAAGAGCAGAAGCGTCTCTGGTGTACTGAATGGAGGCAAATCCATGAG
CCACAACGAATCAACGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001290415
Insert Size 579 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001290415.1, NP_001277344.1
RefSeq Size 2025 bp
RefSeq ORF 579 bp
Locus ID 14168
UniProt ID P70377
Gene Summary Microtubule-binding protein which directly binds tubulin and is involved in both polymerization and stabilization of microtubules. Through its action on microtubules, may participate to the refinement of axons by negatively regulating axonal and leading processes branching. Plays a crucial role in neuron polarization and migration in the cerebral cortex and the hippocampus.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (3) has a distinct N-terminus and is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...