Tle1 (NM_001285531) Mouse Untagged Clone

CAT#: MC226263

Tle1 (untagged) - Mouse transducin-like enhancer of split 1, homolog of Drosophila E(spl) (Tle1), transcript variant 4



  "NM_001285531" in other vectors (1)

CNY 2,000.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TLE1 Antibody - middle region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms C230057C06Rik; Estm14; Grg-1; Grg1; Tle4l
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226263 representing NM_001285531
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTCCCGCAGAGCCGGCACCCAACGCCGCACCAAGCTGCAGGCCAGCCCTTTAAGTTCACTATCCCGG
AGTCTCTGGACCGGATTAAAGAGGAATTCCAGTTCCTGCAGGCGCAGTATCACAGTCTTAAATTGGAGTG
TGAGAAACTGGCAAGTGAAAAGACAGAAATGCAGAGGCACTACGTGATGTATTATGAAATGTCATATGGA
TTAAACATTGAAATGCACAAACAGACTGAAATCGCCAAGAGATTGAACACCATTTGTGCCCAAGTCATCC
CATTTCTGTCTCAGGAACATCAACAACAGGTGGCCCAGGCTGTGGAACGTGCCAAACAGGTGACCATGGC
AGAGTTGAATGCCATCATCGGGCAGCAGCAGTTGCAAGCTCAGCATCTCTCCCATGGCCATGGACCCCCA
GTACCTCTCACGCCTCACCCTTCAGGACTTCAGCCTCCTGGCATCCCGCCCCTTGGGGGCAGTGCCAGCC
TTCTCGCGCTGTCTAGTGCTCTGAGTGGGCAGTCTCACTTGGCAATAAAAGATGACAAGAAGCACCATGA
TGCAGAGCGCCACAGAGGTGAGAGGCCGGGCAAGCCAGATTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001285531
Insert Size 603 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001285531.1, NP_001272460.1
RefSeq Size 2098 bp
RefSeq ORF 603 bp
Locus ID 21885
UniProt ID Q62440
Gene Summary Transcriptional corepressor that binds to a number of transcription factors. Inhibits NF-kappa-B-regulated gene expression. Inhibits the transcriptional activation mediated by FOXA2, and by CTNNB1 and TCF family members in Wnt signaling. The effects of full-length TLE family members may be modulated by association with dominant-negative AES. Unusual function as coactivator for ESRRG (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) lacks several exons in the central and 3' coding regions, but contains an alternate 3' terminal exon, and it thus differs in its 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (d) has a distinct C-terminus and is significantly shorter than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...