Itk (NM_001281967) Mouse Untagged Clone

CAT#: MC226674

Itk (untagged) - Mouse IL2 inducible T cell kinase (Itk), transcript variant 4



  "NM_001281967" in other vectors (1)

CNY 2,660.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Emt; Tcsk; Tsk
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226674 representing NM_001281967
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACAACTTCATCCTCCTGGAAGAACAGCTGATCAAGAAGTCCCAACAGAAGAGAAGGACTTCTCCCT
CGAATTTTAAAGTTCGTTTCTTTGTCTTAACGAAAGCCAGCCTGGCCTACTTTGAGGACCGCCACGGGAA
GAAGCGCACGTTGAAGGGCTCCATTGAACTCTCCAGAATCAAGTGTGTGGAGATTGTCAAGAGTGACATT
AGCATCCCGTGCCACTATAAATACCCTTTTCAGGTCGTGCATGACAACTATCTCCTGTATGTGTTTGCTC
CAGACTGTGAGAGTCGGCAGCGCTGGGTGCTGACCCTTAAAGAAGAAACGAGGAATAACAACAGCCTGGT
ATCCAAGTATCACCCTAATTTCTGGATGGATGGGCGGTGGAGGTGCTGCTCCCAGCTGGAGAAGCCTGCT
GTAGGCTGTGCTCCCTACGACCCATCCAAGAATGCTTCAAAGAAGCCTCTTCCTCCTACTCCTGAAGACA
ACAGGCGGTCATTTCAGGAACCTGAAGAAACCCTGGTCATTGCCTTGTACGACTACCAAACCAACGACCC
TCAGGAGCTCGCACTGCGGTGTGATGAAGAGTACTACCTGCTGGACAGCTCCGAGATCCACTGGTGGAGG
GTTCAAGACAAAAATGGGCATGAAGGATATGCACCAAGCAGTTACCTGGTAGAAAAATCTCCAAATAACC
TTGAAACCTATGAGTGGTACAATAAAAGCATCAGCCGCGACAAAGCTGAAAAACTTCTTTTGGACACAGT
GAAGAAATGGACACGTATACTTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001281967
Insert Size 795 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001281967.1, NP_001268896.1
RefSeq Size 1276 bp
RefSeq ORF 795 bp
Locus ID 16428
Gene Summary Tyrosine kinase that plays an essential role in regulation of the adaptive immune response. Regulates the development, function and differentiation of conventional T-cells and nonconventional NKT-cells. When antigen presenting cells (APC) activate T-cell receptor (TCR), a series of phosphorylation lead to the recruitment of ITK to the cell membrane, in the vicinity of the stimulated TCR receptor, where it is phosphorylated by LCK. Phosphorylation leads to ITK autophosphorylation and full activation. Once activated, phosphorylates PLCG1, leading to the activation of this lipase and subsequent cleavage of its substrates. In turn, the endoplasmic reticulum releases calcium in the cytoplasm and the nuclear activator of activated T-cells (NFAT) translocates into the nucleus to perform its transcriptional duty. Phosphorylates 2 essential adapter proteins: the linker for activation of T-cells/LAT protein and LCP2. Then, a large number of signaling molecules such as VAV1 are recruited and ultimately lead to lymphokine production, T-cell proliferation and differentiation. Phosphorylates TBX21 at 'Tyr-525' and mediates its interaction with GATA3 (PubMed:15662016).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) lacks several exons and its 3'-terminal exon extends past a splice site that is used in variant 1. The encoded isoform (4) has a shorter and distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...