Aup1 (NM_001301649) Mouse Untagged Clone

CAT#: MC226760

Aup1 (untagged) - Mouse ancient ubiquitous protein 1 (Aup1), transcript variant 2



  "NM_001301649" in other vectors (1)

CNY 2,760.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AA589454
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226760 representing NM_001301649
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGATGGATAGGCGGGTGGAGTTGGTGGAGTCACTCAAGAAATTCTGTGCTTCCACGAGGCTTCCGC
CCACACCTTTGCTGCTCTTCCCCGAGGAAGAGGCCACCAATGGCCGAGAAGGGCTGCTGCGTTTCAGTTC
GTGGCCATTTTCTATTCAGGACGTGGTACAACCTCTTACCCTGCAAGTTCAGAGACCCCTGGTCTCTGTG
ACGGTGTCAGATGCCTCCTGGGTCTCAGAACTGCTGTGGTCCCTTTTTGTTCCTTTCACGGTGTATCAAG
TAAGGTGGCTTCATCCCATTCGTCGACAGCTAGGGGAAGAGAGTGAGGAGTTTGCGCTCCGTGTACAACA
GCTGGTGGCCAAAGAATTGGGCCAGATAGGGACACGGCTCACTCCAGCAGACAAAGCAGAACACATGAAG
CGACAAAGACACCCCAGATTACGCCCCCAGTCAGTGCAGTCTTCTTTTCCTTCTCCTCCCAGCCCTTCTT
CTGATGTGCAGCTGACCACTCTCGCTCACAGAGTCAAGGAGGTTCTGCCCCATGTGCCATTGAATGTCAT
CCAGAGAGACCTGGCCAGGACTGGGTGTGTAGACTTGACCATCACAAACCTGCTCGAGGGGGCTGTGGCT
TTCATGCCTGAAGATGTCACTGAGGGATCTCAGTCCCCGCCTGCACCCTCTGCCCCAAAGTTCCCCAGCT
CGGGCCTGGCGACCCCTCAGCCCACAGCCCTAACGTTTGCCAAGTCTTCCTGGGCCCGTCAGGAGAGCCT
GCAGGAGCGCAAGCAGGCACTGTATGAATATGCAAGAAGGAGATTCAGAGAGAGACAGGCCCAGGAGGCT
GAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001301649
Insert Size 846 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001301649.1, NP_001288578.1
RefSeq Size 1508 bp
RefSeq ORF 846 bp
Locus ID 11993
Gene Summary The protein encoded by this gene contains several conserved domains including a hydrophobic domain, an acetyltransferase domain, a ubiquitin binding domain, and a domain required for recruitment of ubiquitin-conjugating enzyme E2 G2 (Ube2g2). In humans, this protein localizes to the endoplasmic reticulum and to lipid droplets. This protein is thought to be involved both in the degradation of misfolded proteins from the endoplasmic reticulum and in the storage of neutral lipids. Reduced expression of the human ortholog of this gene strongly reduces lipid droplet clustering in the cell, and causes stabilization of misfolded proteins. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Transcript Variant: This variant (2) lacks an alternate exon in the coding region and uses a downstream start codon compared to variant 1. It encodes isoform 2 which has a shorter N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...